Entry information : MtRboh06 (Medtr4g109530.1[4.0])
Entry ID 4166
Creation 2006-12-18 (Christophe Dunand)
Last sequence changes 2014-07-31 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtRboh06 (Medtr4g109530.1[4.0])
Name (synonym) MtRboh06 (Medtr4g109530.1[4.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Immature pods
Roots
Inducer Glomus versiforme infection
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh06
start..stop
S start..stop
GmRboh13 1177 0 60..815 60..800
GmRboh04 1125 0 60..815 59..844
EgrRboh07 1014 0 67..815 58..796
CsRboh07 957 0 74..815 63..784
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45518849..45519227 379 N° 2 45518232..45518394 163 N° 3 45518088..45518136 49 N° 4 45517770..45517883 114
N° 5 45517220..45517621 402 N° 6 45515961..45516347 387 N° 7 45515409..45515504 96 N° 8 45515187..45515302 116
N° 9 45514973..45515075 103 N° 10 45514699..45514884 186 N° 11 45514435..45514569 135 N° 12 45514216..45514344 129
N° 13 45514051..45514129 79 N° 14 45513777..45513886 110  
complement(join(45513777..45513886,45514051..45514129,45514216..45514344,4551443 5..45514569,45514699..45514884,45514973..45515075,45515187..45515302,45515409..4 5515504,45515961..45516347,45517220..45517621,45517770..45517883,45518088..45518 136,45518232..45518394,45518849..45519227))


exon

Literature and cross-references MtRboh06 (Medtr4g109530.1[4.0])
Literature Grusak,M.A., Samac,D.A., Town,C.D., Van Aken,S., Utterback,T., Cheung,F. and Fraser,C.M. More ESTs from developing reproductive tissues of Medicago truncatula
DNA ref. Phytozome 11:   chr4 (45519227..45513777)
EST ref. GenBank:   CA918209 [Fragment]
Cluster/Prediction ref. Phytozome Gene 11:   31108372
Protein sequence: MtRboh06 (Medtr4g109530.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   815
PWM (Da):   %s   92407.45 Transmb domain:   %s   o287-304i365-387o420-442i469-491o
PI (pH):   %s   8.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDEHMVKSKTSLLALFKSSPSSSSSSYSSSYSYSHSSSSSCTVENDIDSFYPVQTGSKGLHEAEKCGHVAENEALEVMGLKFINDIVGDQGGIMEWKDVENRFNQVAWTGNGPEPVVSWSQFGFCIGIGMQSSPELARELLRALRGCMQWKSDITKTDLHNFWLRMNDDSFNSRMRLFFDMCNRNMDGRITETDIKTILLTASINKLSVTRDEAEDYAALIMESVDNKNKGYIEISEMETLFKESLLKAYSPMKLQGSTNQDCEEQEQEPMSKVEVLFRTYWRRSWVVVLWLVGCFGLFGWKFDQYSKRSGFEVMGYCLPTAKGAAETLKLNMALILLPVCRNTITWLRNDPRLNYVIPFNDNINFHKLIAGGIVVGVILHGGTHLTCDFPRISDSDKSIFRQTIAAGFGYHQPTYMEILATTEVASGIGMVLIMAIAFSLATKWPRRRSPVLPLSIRRVTGYNTFWYSHHLFVIVYVLLIVHSMFLFLADKWIEKTTWMYIAFPVLLYAGERIFRAIRSGSYEVDVMKASLYPGKVLYLKMQKPDGFKYRSGMYIFIQCPQISPFQWHPFSLTSGPQDEYLSVHIRTLGDWSYQIYALFQAVLSRLQGCPKLYIDGPYGSASQDHVKYDILVLIGLGIGATPFISILKDVANGVQTSQQSNHSGLRECSSTKGSPSKAYLYWVTREQNSFDWFRDVMKEIANSTKQQSVVEMHNFLTSVYPEGDVRSALLSVIQALHHAKNGTDIVSRTPIHTHFARPNWSNIFSRLARKHVEAKIGVFYCGPSNLATELKNLCTKFSTKTTTRFVFHKENY

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 13 introns) and 2 ESTs (BG584576 and CA918209).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGAACACATGGTCAAGTCCAAAACTTCTCTCTTAGCTCTCTTTAAATCATCACCATCCTCTTCATCATCATCTTATTCATCTTCCTATTCTTATTCTCATTCTTCTTCTTCTTCT
TGCACCGTTGAAAATGACATTGATTCATTTTATCCGGTTCAAACCGGGTCCAAGGGTTTGCATGAAGCTGAAAAATGCGGACACGTGGCAGAAAATGAAGCACTTGAAGTGATGGGATTG
AAATTCATCAATGATATTGTTGGTGATCAAGGTGGAATAATGGAGTGGAAGGATGTAGAAAACCGGTTCAACCAAGTAGCTTGGACCGGGAATGGTCCTGAACCTGTCGTGTCATGGTCC
CAATTTGGCTTTTGCATTG
GTGAGAAAATATGAAATTAATTAAGTTAACATTTAATTTATATGCTAACATTATTATGATACTACCACAATTATAATGCATGATATTGATGTAACGTTGCT
GATTGACAAAAACGGTGTCGTTGATAAGTCTATTTCGATGTGTGTCCTTGGTCTGTTCTTTTGTGTTTGCCTTGTGGCACCGTTCAAGTAACATAAGAATCCATAATAATTAATGAATAG
AGGAATTTAATTAGCCACCTTAGCCATGTTCTCAGCATACACTAAAATTCCATTATATAAGACAACTTGTATCATTTTAATTATTCATTTTCCTATACTTTATTTTATTTCAATCATGAG
TAATGTTGTTAATTAACACTTCTTCATTTTTAATTCTCCTTTACCATTTTTTCTTTTCTTAAATAAATCATATCTATACTCTTAGTTTGGCTATATCATTATTTTAATTATAGGGATAGG
GATGCAATCATCACCAGAGTTGGCCAGAGAATTGTTAAGGGCACTACGGGGATGCATGCAATGGAAATCAGATATCACAAAAACTGATTTGCACAATTTTTGGTTACGGATGAATGATGA
TTCTTTTAACTCAAGAATGCGATTGTTCTTTGACAT
GTAAAAAAAATCATCTATACTAAAACTTCAATTAATTTTAACAATTCCTAAAATCTATATGTAATTTTTCCTTTGTTTTTGTTT
AATTACCATAGGTGTAACAGAAACATGGACGGAAGAATTACCGAGACAGATATAAAGCAGGTCATTATTTAATTTAATAAACATTACTAACATATAGTAGCAATTGACACCATTTCAATT
ATCATATGTTCATTGGTCATATTCAGCATGTAGATCATTTGGCACTTCCGGAGACAAACTTTAAAATCATTTCAAGTGGGGTGTACACATACAGTTCTTATTCTGAATGTTTTTAAGAGT
AATTGAATTGATGATATTATACAGACAATATTATTAACCGCTTCCATAAATAAGCTATCGGTGACACGTGATGAAGCAGAAGACTATGCAGCCTTGATAATGGAATCTGTGGACAACAAA
AACAAAGGCTACATTGAG
GTACCATATATTATATTATATTATATTATAGTACTACTCCAATTTAGCCGCCTCAACATTAGAATTTACCATATGCTAGCTGTTAATAATGATTAATGAAAA
ATGTATACTATCAATTATTATGTCCGTGACATATATACATGTGTAGATATCTGAAATGGAGACTCTATTCAAAGAAAGTTTATTAAAAGCATATTCTCCAATGAAATTACAAGGAAGCAC
AAATCAGGATTGTGAAGAACAAGAACAAGAACCAATGTCAAAAGTGGAAGTGTTGTTTAGGACATACTGGCGACGTAGTTGGGTTGTTGTGTTATGGTTGGTTGGTTGCTTTGGTTTGTT
TGGTTGGAAATTTGATCAGTATAGTAAAAGATCAGGATTTGAAGTAATGGGTTATTGTCTTCCAACAGCTAAAGGTGCAGCTGAGACATTGAAACTCAACATGGCTCTTATTCTTCTTCC
TGTTTGTAGAAATACAATCACTTGGCTTCGCAATGATCCCCGTCTTAACTATGTCATTCCTTTTAATGACAACATTAACTTTCATAAG
GTACATGCTTGATCTAATTTATCCACCATCTC
GTGTAAAATAATAATAATTGTCAACAAAATTGATTGCTGTGTATGGGTGGACTAACTACTATTTACCATGTTAGCATTCATGTAAACACATTTAAATGCAGCAAACAATATACTAGTAAC
ATATTTTTGAATAGACTATGTAATTAATTGGCCAATACGATTAAGTTCTATTTTAATATATAATTTTTTTTTTAGCTAAATATACTTTAAAAAAATATTTAGTACGTACTATTTATTAAG
AAAAATTGGTCTAGGCCATATACCACTATGAGACAACCTTAAATATTTACACTATAACTGATAATGTACAACTTATGTACTATGTTTATGTATATGTCTGAGTTGACTTGTTTGAATTTA
TTGACTCACATAAATTTTGTGAAATTGTTTGGAAAAACTTATTTGAAAATAGTTTACGAAAACAATTTATAGTTTCTACGTAAACAATTTAGCTTTATTTTAGTTTTTGTTATAGGAATA
ACTTATACATAAACATTTATCATGATAAACATTTATGCTATAAGCTGCAAATTAAGATGTTTACCAAATCAAGATCTATATATTAAACATCACTTAATTTTTATTATTAAAAAACTATGT
TAACGTCTACATAAAATATTGGTAAGATTTAGTAGTACAACACATTAACTTTCGAGTCTATTTTCGTTTTTAAGTACAACAAAAGAGTTGTGAAAACCTCTCCTGTTATATACAAACAAC
AATTATTTTTGGTGAGATATGTCGAAACTCAAAACCCATATATTGTGACATTGAAATTGAAATCCATTTGAAAAATAACATAAGTACATGATATTTTGCTTCTGGGATATATATATGCAG

CTTATTGCTGGAGGAATAGTGGTGGGTGTGATATTGCATGGAGGGACACACCTTACATGTGATTTCCCAAGAATCAGTGATTCAGACAAATCAATTTTTCGACAAACAATAGCCGCAGGA
TTTGGCTACCACCAACCTACCTACATGGAAATTTTGGCCACAACAGAAGTTGCAAGTGGGATTGGCATGGTGCTGATAATGGCCATTGCATTTTCACTTGCAACAAAGTGGCCAAGGCGT
CGTTCACCTGTGTTGCCCTTGTCCATCAGAAGGGTCACCGGATACAACACCTTTTGGTATTCTCACCACTTGTTTGTCATTGTCTACGTATTGCTCATTGTTCACTCCATGTTCTTGTTC
CTAGCCGACAAGTGGATCGAGAAAACG
GTAAGCTTCTCTGTCTTTTTTCCATTTTCCATCCTTGCCACTTTGCTTGATCTAAATAAAAATCTAATGTTTGTATTACTAACATTACGTTGA
AAGGGAGACTAGACTCTACGAAATACGGTTAGACTCTATGATAGAAATTAGTCATCCACGAAGTAGGTGATAATTTACACCTATAACATGGTTAAAAGAACTGAATTATTCAAGCTTAGT
GTTTTATAAGACATCCAATTTAGCAAATGAATATTGAAGTATATGCAACATTTTTCATTTGTTGAATCATGTTTACTAAATTAATTAAAGTTCTCAATTTCTCGTCACTAGTCTACTGCA
TGATTGTTACTGTCTACCACTTAACATGCCTAAGACAGCAGTAAATGTTACTAAAACTCTTGAAAGTAGCACTAATTTTTGTGTAGATTTTCATTTCCTATATATTTATCTTACTACATG
CAGACATGGATGTACATTGCTTTTCCAGTTTTATTGTATGCTGGAGAGAGGATCTTTCGAGCCATTAGATCAGGATCTTATGAAGTTGATGTTATGAAGGTATTTTTATCAACTTTTTTA
TGTTCAAAATATTCATAAAAGCTGCTGGTTTGAGTTTCTTTTTCATATTAACTAGTATGTTCTTCTCCTTTGATTTTACATGCAGGCAAGTCTCTATCCAGGAAAAGTTCTGTACCTCAA
AATGCAAAAACCAGACGGTTTTAAGTACAGAAGTGGCATGTATATATTCATTCAGTGCCCCCAAATTTCACCCTTTCAATG
GTATTAGTTCAACCTTTTCATTTAATATTAATCCAATTC
ATTCTTGCAGTTTGAAACTAGTTAATCAAGATTGATGTTCAATTTTTGAATCTATTTTGCCTAAATTTTCAGGCATCCATTTTCCCTGACATCAGGACCACAAGACGAGTACCTGAGTGT
GCACATTAGAACTCTTGGTGACTGGAGCTACCAAATATATGCTCTATTCCAAGAG
GTAAGAAATTTACATTTTAAAAAAAATGCAGAATTATAGGTTTCTCAAAATTTTCCAGTCTCAAA
ATTGTTACTGCAATATTCTGCAGGCAGTGTTGTCCAGGTTGCAAGGGTGTCCAAAACTGTACATAGATGGCCCTTATGGTTCTGCTTCTCAAGACCATGTAAAGTATGACATTCTAGTAC
TTATTGGTCTTGGCATAGGAGCTACACCTTTCATTAGCATCCTCAAAGATGTTGCTAATGGTGTCCAGACATCACAACAAAGTAATCAT
GTAAGCTTCTTTTGTTTTGCTAATAATATTT
TTTTCTTCTTGTGTGTGATATTTACTGCATTCACTAAAATTCAATTGCTCCACTTCTGTTCCATGAAATAAATGACACATTTGGGCATTTGAAAATAGAGTGGTCTCAGAGAATGCAGCT
CAACAAAAGGTTCACCATCAAAAGCATATTTATATTGGGTTACAAGAGAACAAAACTCCTTTGATTGGTTTAGAGATGTAATGAAGGAAATAGCAAATTCAACAAAACAGCAG
GTATGTA
TTCCTGATGCAATTTATCATAAAGATGCATAATTAAAATCTTCAATCATTTTCTGACCATTATAATTTTCTTGAATGTTTAAGTCGGTTGTGGAGATGCATAATTTCCTGACTAGTGTAT
ATCCTGAGGGAGATGTTCGTTCGGCTTTGCTAAGTGTCATTCAAGCTTTACATCATGCTAAGAATGGCACTGACATAGTTTCTAGGACTCCT
GTAAGTGCATCTTATCCTTAACTTTGGC
CATTATATGTACAGACAAATTATGAAAAAATATAGTGATTTTGTCTCTGAATTTTCAGATTCACACACATTTTGCTCGACCAAACTGGTCCAACATATTTTCCAGATTGGCTCGCAAGCA
TGTGGAAGCTAAGATTG
GTGAGAAAAATATCATTATGTATATTTAAAAAAGTATGCTAAATTATACATGTCATTAACTTAGCATACTTTGTCATCATTCTATATTATTTAAGTTAATGAT
TGAAATAGACATCATTCTATATTATCTTTTAAGTTCTAACTATGTGGATTTCCTACTACAGGAGTTTTTTATTGTGGACCATCTAACTTAGCAACAGAGTTGAAGAATTTGTGCACCAAA
TTTTCCACCAAAACCACAACTAGATTTGTTTTCCACAAGGAAAATTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGAACACATGGTCAAGTCCAAAACTTCTCTCTTAGCTCTCTTTAAATCATCACCATCCTCTTCATCATCATCTTATTCATCTTCCTATTCTTATTCTCATTCTTCTTCTTCTTCT
TGCACCGTTGAAAATGACATTGATTCATTTTATCCGGTTCAAACCGGGTCCAAGGGTTTGCATGAAGCTGAAAAATGCGGACACGTGGCAGAAAATGAAGCACTTGAAGTGATGGGATTG
AAATTCATCAATGATATTGTTGGTGATCAAGGTGGAATAATGGAGTGGAAGGATGTAGAAAACCGGTTCAACCAAGTAGCTTGGACCGGGAATGGTCCTGAACCTGTCGTGTCATGGTCC
CAATTTGGCTTTTGCATTG
GGATAGGGATGCAATCATCACCAGAGTTGGCCAGAGAATTGTTAAGGGCACTACGGGGATGCATGCAATGGAAATCAGATATCACAAAAACTGATTTGCAC
AATTTTTGGTTACGGATGAATGATGATTCTTTTAACTCAAGAATGCGATTGTTCTTTGACAT
GTGTAACAGAAACATGGACGGAAGAATTACCGAGACAGATATAAAGCAGACAATATTA
TTAACCGCTTCCATAAATAAGCTATCGGTGACACGTGATGAAGCAGAAGACTATGCAGCCTTGATAATGGAATCTGTGGACAACAAAAACAAAGGCTACATTGAG
ATATCTGAAATGGAG
ACTCTATTCAAAGAAAGTTTATTAAAAGCATATTCTCCAATGAAATTACAAGGAAGCACAAATCAGGATTGTGAAGAACAAGAACAAGAACCAATGTCAAAAGTGGAAGTGTTGTTTAGG
ACATACTGGCGACGTAGTTGGGTTGTTGTGTTATGGTTGGTTGGTTGCTTTGGTTTGTTTGGTTGGAAATTTGATCAGTATAGTAAAAGATCAGGATTTGAAGTAATGGGTTATTGTCTT
CCAACAGCTAAAGGTGCAGCTGAGACATTGAAACTCAACATGGCTCTTATTCTTCTTCCTGTTTGTAGAAATACAATCACTTGGCTTCGCAATGATCCCCGTCTTAACTATGTCATTCCT
TTTAATGACAACATTAACTTTCATAAG
CTTATTGCTGGAGGAATAGTGGTGGGTGTGATATTGCATGGAGGGACACACCTTACATGTGATTTCCCAAGAATCAGTGATTCAGACAAATCA
ATTTTTCGACAAACAATAGCCGCAGGATTTGGCTACCACCAACCTACCTACATGGAAATTTTGGCCACAACAGAAGTTGCAAGTGGGATTGGCATGGTGCTGATAATGGCCATTGCATTT
TCACTTGCAACAAAGTGGCCAAGGCGTCGTTCACCTGTGTTGCCCTTGTCCATCAGAAGGGTCACCGGATACAACACCTTTTGGTATTCTCACCACTTGTTTGTCATTGTCTACGTATTG
CTCATTGTTCACTCCATGTTCTTGTTCCTAGCCGACAAGTGGATCGAGAAAACG
ACATGGATGTACATTGCTTTTCCAGTTTTATTGTATGCTGGAGAGAGGATCTTTCGAGCCATTAGA
TCAGGATCTTATGAAGTTGATGTTATGAAG
GCAAGTCTCTATCCAGGAAAAGTTCTGTACCTCAAAATGCAAAAACCAGACGGTTTTAAGTACAGAAGTGGCATGTATATATTCATTCAG
TGCCCCCAAATTTCACCCTTTCAATG
GCATCCATTTTCCCTGACATCAGGACCACAAGACGAGTACCTGAGTGTGCACATTAGAACTCTTGGTGACTGGAGCTACCAAATATATGCTCTA
TTCCAAGAG
GCAGTGTTGTCCAGGTTGCAAGGGTGTCCAAAACTGTACATAGATGGCCCTTATGGTTCTGCTTCTCAAGACCATGTAAAGTATGACATTCTAGTACTTATTGGTCTTGGC
ATAGGAGCTACACCTTTCATTAGCATCCTCAAAGATGTTGCTAATGGTGTCCAGACATCACAACAAAGTAATCAT
AGTGGTCTCAGAGAATGCAGCTCAACAAAAGGTTCACCATCAAAA
GCATATTTATATTGGGTTACAAGAGAACAAAACTCCTTTGATTGGTTTAGAGATGTAATGAAGGAAATAGCAAATTCAACAAAACAGCAG
TCGGTTGTGGAGATGCATAATTTCCTGACT
AGTGTATATCCTGAGGGAGATGTTCGTTCGGCTTTGCTAAGTGTCATTCAAGCTTTACATCATGCTAAGAATGGCACTGACATAGTTTCTAGGACTCCT
ATTCACACACATTTTGCTCGA
CCAAACTGGTCCAACATATTTTCCAGATTGGCTCGCAAGCATGTGGAAGCTAAGATTG
GAGTTTTTTATTGTGGACCATCTAACTTAGCAACAGAGTTGAAGAATTTGTGCACCAAATTT
TCCACCAAAACCACAACTAGATTTGTTTTCCACAAGGAAAATTACTAA

Retrieve as FASTA