Entry information : PnoPGHS01
Entry ID 4168
Creation 2007-01-31 (Marcel Zamocky)
Last sequence changes 2007-01-31 (Marcel Zamocky)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoPGHS01
Name PnoPGHS01
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoPGHS01
start..stop
S start..stop
RrufPGHS 884 0 5..623 2..624
AbraPGHS 857 0 36..623 200..763
XparPGHS 793 0 11..618 8..624
HpulPGHS 774 0 11..623 8..623
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 153531..154001 471 N° 2 152044..153379 1336 N° 3 151917..151981 65  
complement(join(151917..151981,152044..153379,153531..154001))


exon

Literature and cross-references PnoPGHS01
Literature Birren,B., Lander,E., Galagan,J., Devon,K., Nusbaum,C., Jaffe,D.,
Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Kleber,M.,
Mauceli,E., Brockman,W., Rounsley,S., Young,S., LaButti,K.,
Pushparaj,V., DeCaprio,D., Crawford,M., Koehrsen,M., Engels,R.,
Montgomery,P., Pearson,M., Howarth,C., Kodira,C., Zeng,Q.,
Yandava,C., Alvarado,L., Oleary,S., Oliver,R.O. and Solomon,P.
CONSRTM The Broad Institute Genome Sequencing Platform
TITLE Annotation of the Phaeosphaeria nodorum SN15 genome. Zamocky M. et al. (2007) Phylogenetic relationship in the peroxidase-cyclooxygenase superfamily (In preparation).
Protein ref. UniProtKB:   Q0URU2
DNA ref. JGI genome:   scaffold_8 (154001..151917)
Protein sequence: PnoPGHS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   623
PWM (Da):   %s   70009.15  
PI (pH):   %s   6.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTPSKSEPYNYTPSLPQRALVFVYKGINKIIPWHKLPTYIGVLNLSAYRYELRSKNLHDVYPSREDQGTRGCPAITDEQFLHTRHSDGLFNDLEASKMGCVGMRFGRNVAREHTARPSHEELMTPNPRLISEQLLKRDKFKPATSLNLLAAAWIQLHENSTTEQHRVPLPAGDAWNSPDGKMKIDATQDDEPLDQTDNTSPAYKNINTHWWDGSQIYGSSEAHTTGLRLGATNGKLLVDEQKFATFLPRDANCIPQTGFNTNWWLGLEILHTLFVLEHNAICDALHISYPDWTSEKLFDTARLVNCALMAKIHTTEWTPAILAHPALEISMNANWWGILGERLYKLLGRVSKTSEALSGIPGSTVEHHAAPYSLTEEFVSVYRMHSLIPDSIAFFSASNGAHKQTYPIQSVAFEHTRTPFEKSNLSFADIFYSFGINYPGAITLNNMPHFLKDLHTPDGRHIDLGTIDILRDRERGVPRYNQFRRLFHMPAQPSFLAITGGNKVVADKLAKLYNDDIETVDLLIGCLAEPLPKGFGFSDTAFRVFILMASRRLKSDRFIAGDWNTETYSEVGMKWVQGNVMKDVLGRHFPELKGVLGGSGNAFAPWSMMEGSREYQGVETNA

Retrieve as FASTA  
Remarks Softberry predicted 3 exons in the genomic DNA. Strain="SN15". Exon/intron distribution still under discussion.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTACACCTTCCAAGTCTGAGCCTTACAACTACACCCCCAGTCTACCCCAACGCGCACTTGTATTCGTATACAAAGGCATCAATAAGATCATACCATGGCACAAATTACCCACCTAT
ATCGGTGTCCTTAACCTAAGCGCATATCGCTATGAGCTGCGCTCGAAGAATCTCCACGACGTGTACCCGTCACGCGAGGATCAAGGCACGCGCGGCTGTCCTGCCATCACCGACGAACAA
TTCCTACATACAAGACATTCGGATGGCTTGTTCAACGACTTGGAGGCATCAAAGATGGGATGCGTTGGAATGCGTTTTGGACGGAATGTTGCTCGCGAGCATACTGCCAGGCCGAGTCAC
GAAGAGTTGATGACACCGAATCCAAGATTGATCAGTGAGCAGCTGTTGAAGAGGGACAAGTTCAAGCCAGCCACTAGCTTGAATTTGTTGGCCGCAGCCTGGATCCAGTTG
GTACGTGTA
CAGCCTTTTTTGTCAGCACACTCAAATGCATCTGCTGACGTCCAGGTAGTAAGTTCACTGTTATAGCAGCTCATCTAATGTCCAGATGTATCGTCTTGATTATGTACTCACTACCTCTAG
CCAAGTGCATGACTGGTTTCAGCACGAAAACTCTACCACAGAACAACATCGAGTTCCACTTCCTGCTGGCGATGCATGGAACAGTCCCGATGGTAAGATGAAAATTGACGCCACCCAGGA
TGACGAGCCTCTCGACCAGACCGACAACACCTCTCCTGCTTACAAAAATATAAACACGCACTGGTGGGATGGTAGTCAAATTTACGGCTCGTCCGAAGCTCACACAACTGGTTTACGTCT
CGGTGCGACTAACGGCAAGCTTCTCGTCGATGAGCAAAAGTTTGCTACTTTCCTTCCTCGCGACGCGAATTGTATCCCTCAAACGGGTTTCAACACAAATTGGTGGCTTGGGCTTGAGAT
TCTCCACACTCTATTCGTCCTCGAGCACAACGCCATCTGTGACGCTCTGCACATTTCCTACCCCGACTGGACCTCTGAGAAACTCTTCGACACCGCTCGCCTCGTCAATTGCGCACTGAT
GGCAAAGATCCACACTACAGAATGGACGCCCGCAATTCTCGCACATCCCGCTCTCGAAATCAGCATGAACGCAAACTGGTGGGGCATCCTAGGAGAACGACTCTACAAGCTCCTGGGCCG
CGTGAGCAAAACATCAGAAGCCCTATCGGGCATCCCCGGGTCCACCGTCGAGCACCATGCCGCGCCCTACTCCCTCACTGAAGAATTCGTCAGCGTGTACCGCATGCACTCCCTAATTCC
CGACTCCATCGCCTTCTTCTCCGCCTCCAACGGCGCCCACAAACAAACCTACCCCATCCAATCAGTCGCCTTCGAGCACACCCGCACACCCTTTGAGAAATCTAACCTCTCCTTCGCCGA
CATCTTCTACAGCTTCGGCATCAACTACCCCGGCGCAATCACCCTCAACAACATGCCGCATTTTCTGAAGGACTTGCACACCCCTGATGGGAGACACATCGACCTCGGCACCATCGACAT
CCTGCGCGATAGAGAACGCGGCGTCCCGCGCTACAACCAATTCCGCCGGCTGTTCCACATGCCCGCTCAACCCTCGTTCCTCGCCATTACCGGCGGCAACAAGGTCGTCGCGGACAAACT
CGCTAAACTTTATAACGACGACATCGAAACGGTGGACTTGTTGATCGGGTGCCTCGCTGAGCCTTTACCTAAGGGCTTCGGCTTCAGCGACACTGCGTTCCGCGTGTTTATTCTCATGGC
GAGTAGGCGGCTCAAGAGCGATAGGTTCATTGCGGGGGATTGGAATACGGAGACGTATAGTGAAGTGGGGATGAAGTGGGTGCAGGGGAATGTGATGAAGGATGTGCTGGGCAGGCATTT
CCCGGAGTTGAAGGGGGTTCTCGGGGGGAGTGGGAATG
GTAAGTACACCTCGTATTTTGAGTAGGCTGAGATGGGGAATTGGGCTAATGCTTGTGTGTAGCTTTTGCGCCGTGGAGTATG
ATGGAGGGAAGTAGGGAGTATCAGGGGGTGGAGACGAATGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTACACCTTCCAAGTCTGAGCCTTACAACTACACCCCCAGTCTACCCCAACGCGCACTTGTATTCGTATACAAAGGCATCAATAAGATCATACCATGGCACAAATTACCCACCTAT
ATCGGTGTCCTTAACCTAAGCGCATATCGCTATGAGCTGCGCTCGAAGAATCTCCACGACGTGTACCCGTCACGCGAGGATCAAGGCACGCGCGGCTGTCCTGCCATCACCGACGAACAA
TTCCTACATACAAGACATTCGGATGGCTTGTTCAACGACTTGGAGGCATCAAAGATGGGATGCGTTGGAATGCGTTTTGGACGGAATGTTGCTCGCGAGCATACTGCCAGGCCGAGTCAC
GAAGAGTTGATGACACCGAATCCAAGATTGATCAGTGAGCAGCTGTTGAAGAGGGACAAGTTCAAGCCAGCCACTAGCTTGAATTTGTTGGCCGCAGCCTGGATCCAGTTG
CACGAAAAC
TCTACCACAGAACAACATCGAGTTCCACTTCCTGCTGGCGATGCATGGAACAGTCCCGATGGTAAGATGAAAATTGACGCCACCCAGGATGACGAGCCTCTCGACCAGACCGACAACACC
TCTCCTGCTTACAAAAATATAAACACGCACTGGTGGGATGGTAGTCAAATTTACGGCTCGTCCGAAGCTCACACAACTGGTTTACGTCTCGGTGCGACTAACGGCAAGCTTCTCGTCGAT
GAGCAAAAGTTTGCTACTTTCCTTCCTCGCGACGCGAATTGTATCCCTCAAACGGGTTTCAACACAAATTGGTGGCTTGGGCTTGAGATTCTCCACACTCTATTCGTCCTCGAGCACAAC
GCCATCTGTGACGCTCTGCACATTTCCTACCCCGACTGGACCTCTGAGAAACTCTTCGACACCGCTCGCCTCGTCAATTGCGCACTGATGGCAAAGATCCACACTACAGAATGGACGCCC
GCAATTCTCGCACATCCCGCTCTCGAAATCAGCATGAACGCAAACTGGTGGGGCATCCTAGGAGAACGACTCTACAAGCTCCTGGGCCGCGTGAGCAAAACATCAGAAGCCCTATCGGGC
ATCCCCGGGTCCACCGTCGAGCACCATGCCGCGCCCTACTCCCTCACTGAAGAATTCGTCAGCGTGTACCGCATGCACTCCCTAATTCCCGACTCCATCGCCTTCTTCTCCGCCTCCAAC
GGCGCCCACAAACAAACCTACCCCATCCAATCAGTCGCCTTCGAGCACACCCGCACACCCTTTGAGAAATCTAACCTCTCCTTCGCCGACATCTTCTACAGCTTCGGCATCAACTACCCC
GGCGCAATCACCCTCAACAACATGCCGCATTTTCTGAAGGACTTGCACACCCCTGATGGGAGACACATCGACCTCGGCACCATCGACATCCTGCGCGATAGAGAACGCGGCGTCCCGCGC
TACAACCAATTCCGCCGGCTGTTCCACATGCCCGCTCAACCCTCGTTCCTCGCCATTACCGGCGGCAACAAGGTCGTCGCGGACAAACTCGCTAAACTTTATAACGACGACATCGAAACG
GTGGACTTGTTGATCGGGTGCCTCGCTGAGCCTTTACCTAAGGGCTTCGGCTTCAGCGACACTGCGTTCCGCGTGTTTATTCTCATGGCGAGTAGGCGGCTCAAGAGCGATAGGTTCATT
GCGGGGGATTGGAATACGGAGACGTATAGTGAAGTGGGGATGAAGTGGGTGCAGGGGAATGTGATGAAGGATGTGCTGGGCAGGCATTTCCCGGAGTTGAAGGGGGTTCTCGGGGGGAGT
GGGAATG
CTTTTGCGCCGTGGAGTATGATGGAGGGAAGTAGGGAGTATCAGGGGGTGGAGACGAATGCGTAG

Retrieve as FASTA