Entry information : MtRboh09 ( Medtr7g060540.1[4.0] / Medtr7g067680.1[3.0])
Entry ID 4169
Creation 2006-12-20 (Christophe Dunand)
Last sequence changes 2016-04-05 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-04-06 (Christophe Dunand)
Peroxidase information: MtRboh09 ( Medtr7g060540.1[4.0] / Medtr7g067680.1[3.0])
Name (synonym) MtRboh09 ( Medtr7g060540.1[4.0] / Medtr7g067680.1[3.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducers Glomus versiforme infection
Mycorrhiza
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh09
start..stop
S start..stop
GmRboh11 1389 0 1..851 1..859
GmRboh14 1332 0 1..851 1..860
EgrRboh06 1215 0 10..851 3..857
EguRboh06 1213 0 10..851 3..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21876949..21877318 370 N° 2 21877425..21877590 166 N° 3 21878181..21878229 49 N° 4 21878454..21878567 114
N° 5 21878654..21879463 810 N° 6 21879553..21879648 96 N° 7 21879735..21879850 116 N° 8 21879949..21880051 103
N° 9 21880582..21880676 95 N° 10 21880748..21880913 166 N° 11 21881296..21881448 153 N° 12 21881532..21881660 129
N° 13 21881755..21881833 79 N° 14 21882328..21882437 110  
join(21876949..21877318,21877425..21877590,21878181..21878229,21878454..21878567 ,21878654..21879463,21879553..21879648,21879735..21879850,21879949..21880051,218 80582..21880676,21880748..21880913,21881296..21881448,21881532..21881660,2188175 5..21881833,21882328..21882437)


exon

Literature and cross-references MtRboh09 ( Medtr7g060540.1[4.0] / Medtr7g067680.1[3.0])
Literature Harrison,M.J., Liu,J., Town,C.D., Van Aken,S., Utterback,T., Cho,J. and Fraser,C.M. ESTs from roots of Medicago truncatula after colonization with Glomus versiforme, 2001
Protein ref. UniProtKB:   G7L3G1
DNA ref. GenBank:   AC169182 (14941..20426) Phytozome 11:   chr7 (21876949..21882437)
EST ref. GenBank:   BG587472   AW256730 [5' end]   BE941228.1 [3' end]
Cluster/Prediction ref. Phytozome Gene 11:   31084104
Omic ref. Gene atlas:   Mtr.27053.1.S1_at   Mtr.28283.1.S1_at   Mtr.3593.1.S1_at
Protein sequence: MtRboh09 ( Medtr7g060540.1[4.0] / Medtr7g067680.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   851
PWM (Da):   %s   96849.32 Transmb domain:   %s   o292-311i431-453o473-495i664-681o
PI (pH):   %s   8.87
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSEKEGTDESSKWILESIDIVPNVEVPKKDEENESKVIKASDNEAFSNVDNLRSRNNNNNINNNGSKMRRMESGAARGLKGLRFLDRTVTGKEADAWKSIEKRFTQHAVDGMLSKDKFGTCMGMGADSKDFAGELYEALARRRNICAENGITLNEARVFWEDMTNKDLESRLQVFFDMCDKNGDGRLSEEEVKVIVLSASANRLGNLKQHADNYASLIMEELDPDHNGYIEMWQLETLLREMVSAEDGKPKLGTRTQTLTRAMIPCKYRTPIRKWITKTAEFVNEQWKKIWIIVLWLAINLVLFVWKFLQYKERPAYEVMGSCLCFAKGSAETLKFNMALIVLTMCRRTLTKLRGTFLSQIIPFDDNINFHKIIAVGVVIGTLIHVGVHVSCDFPRLVSCPTEKFMAILGSGFDYKQPSYLTLVTSPPGITGIFMVLIMAFSFTLATHYFRKSVVTLPSPLHHLAGFNSFWYAHHLLILVYILLVIHGYFLFLTKAWHKKTTWMYLVVPLVLYGIERVHPFYKSKDHRVNVIKAIIYTGNVLALYMTRPQGFKYQSGMYLFVKCPDISSFEWHPFSITSAPGDDYLSVHIRTLGDWTTELRNIFAACEPQSAIPRGSLMRMETRAYSKSSIDNSKPSIRYPKILIKGPYGAPAQSYKHYDVLLLIGLGIGATPMISILKDILNQMKMASPQEKSEKGSFSSNSSDEDRKGPERAYFYWVTREQASFEWFKGVMDDIAEHDSDGVIEMHNYLTSVYEEGDARSALIAMIQRLQHAKNGVDVVSESRIRTHFARPNWKKVFSQLATTHESSRIGVFYCGSPTLTKSLKSLCQEFSLNTSTRFHFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 13 introns ) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCAGAAAAAGAAGGTACAGATGAATCATCAAAATGGATTCTTGAAAGCATTGATATCGTTCCTAATGTGGAAGTTCCTAAAAAGGATGAAGAAAATGAAAGCAAGGTTATAAAA
GCTTCTGATAATGAAGCATTTTCGAATGTCGATAATTTGAGGAGCAGGAATAATAATAACAATATTAACAATAATGGAAGCAAAATGCGAAGGATGGAATCAGGTGCTGCAAGAGGGCTT
AAGGGTTTACGGTTTCTTGATAGAACGGTTACAGGTAAAGAAGCTGATGCATGGAAGTCAATTGAGAAACGTTTTACGCAACATGCAGTTGATGGAATGTTATCAAAAGACAAATTTGGA
ACATGCATGG
GTAACAATGTTGTTTTTGCTTTCTTGTTTTTGTTTTTTGTTTCTAATGATTTTAGTTGTTTGTTCTGAAGTTTGAGTTATGAATGTTGAAAACAATGTTTATATAGGTAT
GGGAGCAGATTCAAAGGATTTTGCTGGGGAACTGTATGAGGCATTGGCAAGGAGAAGGAATATATGTGCAGAAAATGGAATTACTTTGAATGAAGCTAGGGTTTTTTGGGAGGATATGAC
TAATAAAGATCTTGAATCAAGACTTCAAGTGTTCTTTGACAT
GTAAGGTCTATAAACATAGAAAACTTTATGTATATACCTTTCGCATGTTTTTTTTTGTCGGGTAGCCCTGGTGGCTGG
AATCCACCTTTTTCAAGATGAATAAGTGGGGTGTTCGAGGTTCGAACCCCAGCCCTGCATATAACAATCCATGTACCTGCCAACTTAGCTATGCTCATGGGGACAAACCTTCTGCATGTT
AATAACTTTAGATGGGCAAAACCTGCTTGAGTTGGCCTAGTGGTATTGACTTGGGACCTGGGAGGGTGCTCCTCCTTAAGGTCTCACGTTCGATTCTCCACGGTGCCAAATTGAGTGGGC
TAATTTAACTTCTTAAAAAAAAAATTAGATAGCCAAATGTTGGTATATTAGTAGCTTCTTCAAAAAAACAAAACTTTAGATAGGCAAATGTTGGTATAGTAGATGTTATTATGTTACTAT
TTTCTCCTTCTTCCGGGGTTGAGCTCTGGCCCTTTTAGCTCCTTCAACATTTTAACCTTTAGCTCGAACTATTTGAGCTACCTACTTTTGCATGTTAAATGAATGATTTCATATTGAGTG
GAGTTATATAAAAGAACTAAAGTCATTTTCAGGTGTGACAAGAATGGAGATGGTAGGTTATCCGAAGAGGAGGTTAAGGAGGTGAGTATTGAGATTATGTAAATTCTTTTTATACCAATC
TTTTTTCCTATGATGCACTGACCAAAAACAGACTCAAACATTGGTAATAGTTTGAAAAATTGAAATGATTGTATGTTCATGTGTCAGATATTTGGTCACGCTTTCAATACATATTGTCGA
GTGTTGGTGCTACGTAGCTTTATACAATTCTGTTAAATAGAATTCTAACTGTTTTTGTGTAAAAGGTTATAGTGTTGAGTGCTTCTGCAAATAGATTGGGAAATCTTAAACAACATGCTG
ATAATTATGCTTCTTTGATCATGGAAGAGCTTGATCCAGATCATAATGGATATATAGAG
GTAATTAGAATTAGAAGCCGATTAAATTGTAACGACATATATCTTCTGTTCAGAATGTTTT
TTAAATTTACATCTCTTGAAAACAGATGTGGCAGCTTGAAACTCTATTAAGGGAAATGGTTAGTGCAGAAGATGGCAAACCAAAACTTGGTACAAGAACACAAACTTTAACTAGAGCTAT
GATACCATGCAAGTATCGAACTCCTATTAGAAAATGGATCACGAAAACCGCAGAATTTGTAAATGAACAGTGGAAAAAAATATGGATTATCGTTCTTTGGTTAGCCATAAACTTGGTACT
TTTCGTTTGGAAGTTTCTCCAATACAAGGAAAGACCAGCATATGAAGTAATGGGATCATGTCTATGTTTTGCAAAGGGTTCTGCTGAGACTCTCAAATTCAACATGGCTCTAATTGTCCT
TACAATGTGTAGAAGAACACTTACAAAGTTACGAGGAACATTTCTTAGTCAAATCATTCCTTTTGATGACAACATAAACTTTCATAAAATCATTGCAGTTGGCGTAGTTATAGGAACTTT
AATCCATGTAGGTGTGCATGTATCTTGTGATTTTCCAAGATTAGTTTCTTGTCCGACCGAAAAATTTATGGCGATACTTGGATCCGGTTTTGATTATAAGCAGCCTAGTTACTTGACCCT
TGTTACAAGTCCTCCTGGTATAACTGGAATTTTCATGGTCTTGATTATGGCTTTTTCTTTCACTTTGGCAACTCATTACTTTAGAAAAAGCGTTGTCACGTTACCTTCGCCGTTGCATCA
TTTGGCCGGATTCAATTCCTTTTGGTATGCTCATCATTTGCTTATTCTGGTGTATATACTCCTAGTCATACATGGATACTTTCTATTTCTCACAAAGGCTTGGCATAAAAAGACG
GTATG
TGTCATTCTCTTAACATTCTAAATTATTCAAATTACCAAAATTTCAGTACCGATTCAGATTTAAATTATTCTCTCTAAATGCAGACTTGGATGTACCTTGTAGTTCCACTAGTGCTCTAT
GGTATTGAGAGAGTTCATCCATTTTATAAGAGTAAAGATCACCGCGTGAACGTCATTAAG
GTATGTGTGTGTGTCAACAAATTCTCCTCCTTGAATTTTTATTTATGCCGAAACAGGAAA
ATAATATTACTATTTGAATATTTCAGGCAATAATCTACACAGGAAATGTTCTAGCACTATACATGACCAGGCCACAAGGATTCAAGTATCAAAGTGGAATGTATCTTTTTGTCAAGTGTC
CAGATATATCTAGTTTTGAATG
GTAATTATGATCTACTTGGATGATATTTTGAGCACAAAAGTTAATTTTTCTGCAAAATTATTTTTACTTAGGACAATCGAATTTACTCTTTTTTACAG

GCATCCTTTCTCCATCACCTCTGCACCTGGAGACGATTACTTGAGTGTTCATATACGAACCTTAGGAGATTGGACTACAGAACTTAGAAACATATTTGCAAAG
GTGATGTTTATGTATGA
ACTGAGAACTCAACCATATGTTCAGTTAGGTATGAAGCACGCATACAGACACGGACACCGGACAACACGAACACTAACATGTGGACATCGCTAATAATTTGAGAAAATTACATAATTCAG
TGTAATTACAAGTGTCGGTGTCGGACACGACACATGTCCGACACCAGGACACGCCTAATCCGAGAAGTGTCCGTGCTTCATAGAGTCAAGGTTTATCAGAAATAGGGTTGAATATGTTTT
TAGAATTACGGATGTTTCAAGCTTCGTCGCTATAAAAAATTGAACCACAATATTCGGTCCCTGCATTTTATCCCTACCAATGCTTTTAGTACGTACAGAGGACTAAGAAACGTATCCATT
ATTTTTAAAGGCATGACTAAAAACACCCGTTTTTATAAAACGGTAGGAGCCTCAAAGGTATAGAGACTAAAAACATATTTAACCTGAGAAATATGATGATCTTTGAACTTGAACATCTAG
TTGTGTACTATTTACTAAGACTTGAACATGCAGGCTTGTGAGCCTCAAAGTGCAATCCCAAGGGGAAGCCTTATGAGGATGGAAACTAGAGCATACTCAAAATCAAGTATTGACAATTCA
AAACCAAG
GTGAATAAAAACTCTTGGTACTTATTTTTCCATAATGTTATGATGTACTGATATTATTTTACCCTTTCTAGTATTAGATATCCAAAGATCCTCATTAAAGGACCCTATGGAG
CACCAGCACAAAGCTATAAGCATTATGATGTACTCTTGCTCATTGGTCTAGGAATTGGGGCCACACCAATGATAAGTATTTTGAAAGATATCTTGAACCAAATGAAGATGGCAAGTCCTC
AACAA
GTAAGTCACAACGAGCCGATTTGACCAACACTTTAGATTGAAGGCCTGTATGGCGGCACGATACTAACATATGTGGTTACATTAAATAACATTATTCTTCTCAAATTATTATAGG
TGTCTATATGTCAGTGTTGAGTCTTTTTCACATATGTGTCAATACTTCATATCTTCTCCAAAAGTACCTAAGGAATTAGTTTCTCGATTTTTTAGATGCTCTCTCATTAGGTTCCACATA
AACATAAACCGTAAATGAAGAACGAAAGATCTCATAAACTAAAAGCTAACCAAAATTAGGCCAAAATTAACAAAGTTTTATATACTTTTTGTAGGTGTATATTTATAGTTTATGCACAAG
TACTAATTCTTAGGGTTAACATAACAGGAAAAGTCTGAGAAGGGCTCCTTCAGTAGCAATAGCTCCGACGAAGATAGAAAAGGTCCTGAAAGAGCATACTTTTATTGGGTAACAAGGGAA
CAAGCTTCATTTGAATGGTTCAAAGGTGTTATGGATGATATTGCAGAACATGACAGTGAT
GTAAGATTAAGTACCAAACTTTTTGCTTTTTAACCTCGACCTAACACAGTTTTAGAAGTT
TTTAACATGTATCAATGCTGCAGGGTGTTATAGAAATGCATAACTATTTGACTAGTGTTTATGAGGAAGGTGATGCAAGATCTGCACTTATTGCCATGATTCAGAGGCTGCAGCATGCTA
AAAATGGAGTTGATGTAGTTTCAGAAAGCCGG
GTATATTTTGATTTAGTTCTCGTTTAGTGTTAACATTTTTTCATAATGCAATCAAAGATTAAGCTTTTATCATATGATGTTATACCAT
ATCCAGATAAGAACTCATTTTGCTAGACCAAACTGGAAAAAGGTCTTCTCTCAGTTAGCTACAACACACGAAAGTTCTCGAATAGGTATGCATAATTGTGAAATTTTTAAGCCCTAATTG
ATTTAAGAAAATGTTTTCTGTCATTAATTTTAATTACAAAACGATCACTTTATGTACGTCCTTTTCTGTTTTCAAATATTTGGATGGAAACACTACAATTTTTGTATCTTTGTTATGGTT
TTATATTCTGGCCACGGTTGTTACGCTGAAAATAGTTATATTACGGAAAAATGTGGACGATGCAGTTGAAATTGTGGTTGCGATGACATTACTAACACCTCAAAATCCTTAATATTGAGG
CCTCAATTTCAATTACAGTCCGTAACTTAAAACCATGATTGTTTCCTATGCATTTTTTTTTGTCAAGTAGCCTAGTAGCTAGAAATTCACCTTTCATAAGGTGAATAAGCGAGGTGTCCG
GGCTTCAAACCCGGACCCCTGCATATATCATGCATTGTCCCTACCAGATTGTTTCCTATTCAAATCTTCGAAATTTATGTTGCTATTTACTTGATACAGGTGTATTTTACTGTGGAAGTC
CTACTCTTACAAAATCATTGAAGAGCCTTTGTCAAGAGTTTAGCCTAAACACATCTACCCGCTTTCATTTTCATAAAGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCAGAAAAAGAAGGTACAGATGAATCATCAAAATGGATTCTTGAAAGCATTGATATCGTTCCTAATGTGGAAGTTCCTAAAAAGGATGAAGAAAATGAAAGCAAGGTTATAAAA
GCTTCTGATAATGAAGCATTTTCGAATGTCGATAATTTGAGGAGCAGGAATAATAATAACAATATTAACAATAATGGAAGCAAAATGCGAAGGATGGAATCAGGTGCTGCAAGAGGGCTT
AAGGGTTTACGGTTTCTTGATAGAACGGTTACAGGTAAAGAAGCTGATGCATGGAAGTCAATTGAGAAACGTTTTACGCAACATGCAGTTGATGGAATGTTATCAAAAGACAAATTTGGA
ACATGCATGG
GTATGGGAGCAGATTCAAAGGATTTTGCTGGGGAACTGTATGAGGCATTGGCAAGGAGAAGGAATATATGTGCAGAAAATGGAATTACTTTGAATGAAGCTAGGGTTTTT
TGGGAGGATATGACTAATAAAGATCTTGAATCAAGACTTCAAGTGTTCTTTGACAT
GTGTGACAAGAATGGAGATGGTAGGTTATCCGAAGAGGAGGTTAAGGAGGTTATAGTGTTGAGT
GCTTCTGCAAATAGATTGGGAAATCTTAAACAACATGCTGATAATTATGCTTCTTTGATCATGGAAGAGCTTGATCCAGATCATAATGGATATATAGAG
ATGTGGCAGCTTGAAACTCTA
TTAAGGGAAATGGTTAGTGCAGAAGATGGCAAACCAAAACTTGGTACAAGAACACAAACTTTAACTAGAGCTATGATACCATGCAAGTATCGAACTCCTATTAGAAAATGGATCACGAAA
ACCGCAGAATTTGTAAATGAACAGTGGAAAAAAATATGGATTATCGTTCTTTGGTTAGCCATAAACTTGGTACTTTTCGTTTGGAAGTTTCTCCAATACAAGGAAAGACCAGCATATGAA
GTAATGGGATCATGTCTATGTTTTGCAAAGGGTTCTGCTGAGACTCTCAAATTCAACATGGCTCTAATTGTCCTTACAATGTGTAGAAGAACACTTACAAAGTTACGAGGAACATTTCTT
AGTCAAATCATTCCTTTTGATGACAACATAAACTTTCATAAAATCATTGCAGTTGGCGTAGTTATAGGAACTTTAATCCATGTAGGTGTGCATGTATCTTGTGATTTTCCAAGATTAGTT
TCTTGTCCGACCGAAAAATTTATGGCGATACTTGGATCCGGTTTTGATTATAAGCAGCCTAGTTACTTGACCCTTGTTACAAGTCCTCCTGGTATAACTGGAATTTTCATGGTCTTGATT
ATGGCTTTTTCTTTCACTTTGGCAACTCATTACTTTAGAAAAAGCGTTGTCACGTTACCTTCGCCGTTGCATCATTTGGCCGGATTCAATTCCTTTTGGTATGCTCATCATTTGCTTATT
CTGGTGTATATACTCCTAGTCATACATGGATACTTTCTATTTCTCACAAAGGCTTGGCATAAAAAGACG
ACTTGGATGTACCTTGTAGTTCCACTAGTGCTCTATGGTATTGAGAGAGTT
CATCCATTTTATAAGAGTAAAGATCACCGCGTGAACGTCATTAAG
GCAATAATCTACACAGGAAATGTTCTAGCACTATACATGACCAGGCCACAAGGATTCAAGTATCAAAGTGGAATG
TATCTTTTTGTCAAGTGTCCAGATATATCTAGTTTTGAATG
GCATCCTTTCTCCATCACCTCTGCACCTGGAGACGATTACTTGAGTGTTCATATACGAACCTTAGGAGATTGGACTACA
GAACTTAGAAACATATTTGCAAAG
GCTTGTGAGCCTCAAAGTGCAATCCCAAGGGGAAGCCTTATGAGGATGGAAACTAGAGCATACTCAAAATCAAGTATTGACAATTCAAAACCAAGT
ATTAGATATCCAAAGATCCTCATTAAAGGACCCTATGGAGCACCAGCACAAAGCTATAAGCATTATGATGTACTCTTGCTCATTGGTCTAGGAATTGGGGCCACACCAATGATAAGTATT
TTGAAAGATATCTTGAACCAAATGAAGATGGCAAGTCCTCAACAA
GAAAAGTCTGAGAAGGGCTCCTTCAGTAGCAATAGCTCCGACGAAGATAGAAAAGGTCCTGAAAGAGCATACTTT
TATTGGGTAACAAGGGAACAAGCTTCATTTGAATGGTTCAAAGGTGTTATGGATGATATTGCAGAACATGACAGTGAT
GGTGTTATAGAAATGCATAACTATTTGACTAGTGTTTATGAG
GAAGGTGATGCAAGATCTGCACTTATTGCCATGATTCAGAGGCTGCAGCATGCTAAAAATGGAGTTGATGTAGTTTCAGAAAGCCGG
ATAAGAACTCATTTTGCTAGACCAAACTGGAAA
AAGGTCTTCTCTCAGTTAGCTACAACACACGAAAGTTCTCGAATAG
GTGTATTTTACTGTGGAAGTCCTACTCTTACAAAATCATTGAAGAGCCTTTGTCAAGAGTTTAGCCTAAACACA
TCTACCCGCTTTCATTTTCATAAAGAGAACTTCTAA

Retrieve as FASTA