Entry information : NcPGHS01
Entry ID 4180
Creation 2007-02-02 (Marcel Zamocky)
Last sequence changes 2007-02-02 (Marcel Zamocky)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcPGHS01
Name NcPGHS01
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcPGHS01
start..stop
S start..stop
NtetPGHS01_2509 1308 0 1..651 1..650
SmaPGHS 1239 0 1..651 1..652
NdisPGHS01 1238 0 1..651 1..648
HpulPGHS 959 0 30..651 5..623
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4631535..4632107 573 N° 2 4632271..4632955 685 N° 3 4633031..4633728 698  
join(4631535..4632107,4632271..4632955,4633031..4633728)


exon

Literature and cross-references NcPGHS01
Literature Galagan,J.E., Calvo,S.E., Borkovich,K.A., Selker,E.U., Read,N.D.,
Jaffe,D., FitzHugh,W., Ma,L.-J., Smirnov,S., Purcell,S., Rehman,B.,
Elkins,T., Engels,R., Wang,S., Nielsen,C.B., Butler,J.,
Endrizzi,M., Qui,D., Ianakiev,P., Pedersen,D., Nelson,M.,
Washburne,M., Selitrennikoff,C.P., Kinsey,J.A., Braun,E.L.,
Zelter,A., Schulte,U., Kothe,G.O., Jedd,G., Mewes,W., Staben,C.,
Marcotte,E., Greenberg,D., Roy,A., Foley,K., Naylor,J., Thomann,N.,
Barrett,R., Gnerre,S., Kamal,M., Kamvysselis,M., Mauceli,E.,
Bielke,C., Rudd,S., Frishman,D., Krystofova,S., Rasmussen,C.,
Metzenberg,R.L., Perkins,D.D., Kroken,S., Cogoni,C., Macino,G.,
Catcheside,D., Li,W., Pratt,R.J., Osmani,S.A., DeSouza,C.C.,
Glass,L., Orbach,M.J., Berglund,J., Voelker,R., Yarden,O.,
Plamann,M., Seiler,S., Dunlap,J., Radford,A., Aramayo,R.,
Natvig,D.O., Alex,L.A., Mannhaupt,G., Ebbole,D.J., Freitag,M.,
Paulsen,I., Sachs,M.S., Lander,E.S., Nusbaum,C. and Birren,B.
"The genome sequence of the filamentous fungus Neurospora crassa."
Nature 422 (6934), 859-868 (2003) Zamocky M. et al. "Phylogenetic relationship in the peroxidase-cyclooxygenase superfamily (2007 in preparation).
Protein ref. UniProtKB_Uniparc:   Q7RUD3
DNA ref. JGI genome:   supercont10.3 (4631535..4633728)
Protein sequence: NcPGHS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   651
PWM (Da):   %s   73419.68  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNTLSKPNGTSSSTSSNNPDDKGKKQVELQPSFTPTLLERLGITSFHLLNKLIPWYKLPGFIGAFNLAFLRIELRQYNLHDAYATSQAQGSSITDPLPNKCYLGARNSDGKFNDLKQPRMGCTGMRFGRNFPREACAKPSEEELMTPNPRMISERFMARKEGKFIPATTLNLLAAAWIQFQTHDWFFHEQDPNEKLNVPLSEDDKWLDQHMQLYATKPDEALDPSDVKCPGYKNLNTHWWDGSQIYGSSESATQTLRNRHPDGKLSLDSRGREQFLPRDQDGNVLTGFNDNWWVGMEILHTLFALEHNAICDALRKEYPDWSGDQIFDKARLVNCALMAKIHTVEWTPAILAHPALQIGMAANWWGIVGEKLTKIAGRLSKTSEIISGIPGSGAEQDGTPYSLTEEFVSVYRMHSLMPETIAFFSAVDGHHATTIPVVDTTFTKSQSPFDDGLSFADVFYSFGINYPGAITNNNYPNFLRNLRTPDGQVRDLGTVDILRDRERGVPRYCEFRRMLRLSVPKTFEELTGGNKVLAKELAEAYNNDISLVDALVGSHSEPVIPGFGFSETAFRIFILMASRRLKSDRFIAGEWNEEMYTKVGFKWVQNSGMKDVLGRHFPELRETLKASKNVFAPWEMQAKSKEYKGVETNA

Retrieve as FASTA  
Remarks Softberry predicted 3 exons, proteins with NCBI id: EAA30056.1 and EAA30057.1 are joined together according to softberry prediction (otherwise EAA30056.1 and EAA30057.1 do not completely cover the peroxidase domain!). Original annotation: related to feebly protein (EAA300571.) and hypothetical protein (EAA30056.1). Both partial sequences are found in SwissProt under the accessions Q7RUD3 (EAA30056) and Q7S3N7 (EAA30057).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACACACTCTCCAAACCAAACGGCACCAGCTCTTCCACCTCGTCCAACAATCCAGACGACAAGGGCAAGAAGCAGGTTGAACTCCAACCCTCCTTCACACCCACCCTCCTCGAA
CGCCTCGGCATCACCTCCTTTCACCTTCTCAACAAGTTAATCCCATGGTACAAACTCCCCGGCTTCATCGGCGCCTTTAACCTGGCCTTCCTGCGCATCGAGCTCCGACAATACAACCTG
CACGACGCCTATGCGACCTCCCAAGCCCAAGGCAGTTCTATCACCGACCCTCTCCCCAACAAATGCTATCTGGGCGCTCGCAACTCCGATGGCAAGTTCAATGATTTGAAACAGCCAAGA
ATGGGATGCACGGGCATGAGGTTCGGGAGGAATTTCCCGCGGGAGGCTTGTGCAAAACCCAGCGAGGAGGAGCTGATGACGCCGAATCCGAGGATGATTAGTGAGAGGTTTATGGCGAGG
AAGGAAGGAAAGTTCATACCGGCGACGACGCTGAATCTGTTGGCGGCGGCGTGGATCCAGTTCCAGACGCATGATTGGTTTTTCCATGAGCAG
GTATGTGACTTTGAGACTTTCCCGTTG
GGAACGGGGATTTTATCGATTATGCATTTGTCGTAGTCCTGTGCAACATCGGGATGTTGTTAGTACGCGTGTGGCTTGGGCTTCTTTCTCCTTCTGAGTTCCGATCATTGGCTGACTTTC
TCCGGTCGTGTTTCAGGACCCCAACGAGAAGCTCAACGTCCCGCTCTCTGAGGACGACAAGTGGCTTGACCAACACATGCAGTTATACGCCACCAAGCCAGATGAGGCTCTCGACCCATC
CGACGTCAAGTGTCCCGGGTACAAGAACCTCAACACCCACTGGTGGGACGGATCACAGATCTACGGCTCCTCCGAGTCCGCAACACAGACGCTCCGCAACCGTCATCCAGACGGCAAGTT
GTCCCTGGACAGTCGCGGGCGTGAGCAATTCCTCCCTCGGGACCAGGATGGAAATGTCCTGACTGGCTTCAACGACAATTGGTGGGTGGGAATGGAGATCCTGCACACGCTGTTTGCGCT
GGAGCACAATGCCATTTGTGATGCGCTGCGCAAGGAGTATCCCGATTGGAGCGGAGACCAGATCTTTGACAAGGCGAGGCTGGTGAACTGTGCTTTGATGGCCAAGATCCATACGGTCGA
GTGGACGCCGGCGATCCTGGCGCATCCGGCATTGCAGATTGGAATGGCCGCTAACTGGTGGGGGATTGTCGGGGAGAAGTTGACCAAGATCGCGGGAAGACTGTCCAAGACGAGCGAGAT
CATTAGTGGCATTCCCGGCAGCGGAGCGGAGCAGGATGGGACGCCGTACTCACTGACGGAGGAGTTCGTGTCGGTTTATCGGATGCATTCCTTGATGCCTG
GTTTGTGCTTCCTTCCTCT
TCCCCAATTCCCTCGGGTGTTATGTACCTCCCACTGACTGCAGTGTCCGTCTGCAGAAACAATCGCCTTCTTCTCCGCCGTTGACGGCCACCACGCCACCACCATCCCCGTGGTCGACAC
CACCTTCACCAAATCGCAAAGCCCGTTCGACGACGGCCTCTCCTTCGCCGACGTCTTCTACTCCTTCGGCATCAACTACCCCGGCGCCATCACCAACAACAACTACCCCAATTTCCTACG
CAACCTGCGCACCCCCGACGGCCAAGTCCGCGACCTCGGAACCGTAGACATCCTCCGCGACCGCGAGCGGGGCGTCCCTCGCTACTGCGAGTTCCGGCGTATGCTCCGTCTCTCGGTGCC
CAAAACCTTTGAAGAACTTACCGGCGGCAACAAGGTCCTCGCCAAAGAACTGGCAGAAGCCTACAACAACGACATCTCCCTTGTGGATGCTTTGGTCGGATCACACTCGGAGCCAGTGAT
TCCAGGGTTCGGGTTCAGCGAGACGGCGTTCAGGATTTTCATTCTAATGGCGAGTAGGAGGCTGAAGAGCGATCGGTTCATTGCCGGCGAGTGGAACGAGGAGATGTACACCAAGGTTGG
GTTCAAGTGGGTGCAGAATAGCGGGATGAAGGATGTGTTGGGGAGACATTTCCCGGAGCTGAGGGAGACGTTGAAGGCGAGCAAGAATGTGTTTGCGCCGTGGGAGATGCAGGCGAAGAG
CAAGGAGTACAAGGGCGTGGAGACGAATGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACACACTCTCCAAACCAAACGGCACCAGCTCTTCCACCTCGTCCAACAATCCAGACGACAAGGGCAAGAAGCAGGTTGAACTCCAACCCTCCTTCACACCCACCCTCCTCGAA
CGCCTCGGCATCACCTCCTTTCACCTTCTCAACAAGTTAATCCCATGGTACAAACTCCCCGGCTTCATCGGCGCCTTTAACCTGGCCTTCCTGCGCATCGAGCTCCGACAATACAACCTG
CACGACGCCTATGCGACCTCCCAAGCCCAAGGCAGTTCTATCACCGACCCTCTCCCCAACAAATGCTATCTGGGCGCTCGCAACTCCGATGGCAAGTTCAATGATTTGAAACAGCCAAGA
ATGGGATGCACGGGCATGAGGTTCGGGAGGAATTTCCCGCGGGAGGCTTGTGCAAAACCCAGCGAGGAGGAGCTGATGACGCCGAATCCGAGGATGATTAGTGAGAGGTTTATGGCGAGG
AAGGAAGGAAAGTTCATACCGGCGACGACGCTGAATCTGTTGGCGGCGGCGTGGATCCAGTTCCAGACGCATGATTGGTTTTTCCATGAGCAG
GACCCCAACGAGAAGCTCAACGTCCCG
CTCTCTGAGGACGACAAGTGGCTTGACCAACACATGCAGTTATACGCCACCAAGCCAGATGAGGCTCTCGACCCATCCGACGTCAAGTGTCCCGGGTACAAGAACCTCAACACCCACTGG
TGGGACGGATCACAGATCTACGGCTCCTCCGAGTCCGCAACACAGACGCTCCGCAACCGTCATCCAGACGGCAAGTTGTCCCTGGACAGTCGCGGGCGTGAGCAATTCCTCCCTCGGGAC
CAGGATGGAAATGTCCTGACTGGCTTCAACGACAATTGGTGGGTGGGAATGGAGATCCTGCACACGCTGTTTGCGCTGGAGCACAATGCCATTTGTGATGCGCTGCGCAAGGAGTATCCC
GATTGGAGCGGAGACCAGATCTTTGACAAGGCGAGGCTGGTGAACTGTGCTTTGATGGCCAAGATCCATACGGTCGAGTGGACGCCGGCGATCCTGGCGCATCCGGCATTGCAGATTGGA
ATGGCCGCTAACTGGTGGGGGATTGTCGGGGAGAAGTTGACCAAGATCGCGGGAAGACTGTCCAAGACGAGCGAGATCATTAGTGGCATTCCCGGCAGCGGAGCGGAGCAGGATGGGACG
CCGTACTCACTGACGGAGGAGTTCGTGTCGGTTTATCGGATGCATTCCTTGATGCCTG
AAACAATCGCCTTCTTCTCCGCCGTTGACGGCCACCACGCCACCACCATCCCCGTGGTCGAC
ACCACCTTCACCAAATCGCAAAGCCCGTTCGACGACGGCCTCTCCTTCGCCGACGTCTTCTACTCCTTCGGCATCAACTACCCCGGCGCCATCACCAACAACAACTACCCCAATTTCCTA
CGCAACCTGCGCACCCCCGACGGCCAAGTCCGCGACCTCGGAACCGTAGACATCCTCCGCGACCGCGAGCGGGGCGTCCCTCGCTACTGCGAGTTCCGGCGTATGCTCCGTCTCTCGGTG
CCCAAAACCTTTGAAGAACTTACCGGCGGCAACAAGGTCCTCGCCAAAGAACTGGCAGAAGCCTACAACAACGACATCTCCCTTGTGGATGCTTTGGTCGGATCACACTCGGAGCCAGTG
ATTCCAGGGTTCGGGTTCAGCGAGACGGCGTTCAGGATTTTCATTCTAATGGCGAGTAGGAGGCTGAAGAGCGATCGGTTCATTGCCGGCGAGTGGAACGAGGAGATGTACACCAAGGTT
GGGTTCAAGTGGGTGCAGAATAGCGGGATGAAGGATGTGTTGGGGAGACATTTCCCGGAGCTGAGGGAGACGTTGAAGGCGAGCAAGAATGTGTTTGCGCCGTGGGAGATGCAGGCGAAG
AGCAAGGAGTACAAGGGCGTGGAGACGAATGCGTAG

Retrieve as FASTA