Entry information : MgrLDS02
Entry ID 4181
Creation 2006-12-20 (Christophe Dunand)
Last sequence changes 2006-12-20 (Christophe Dunand)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MgrLDS02
Name MgrLDS02
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Magnaporthe
Organism Magnaporthe grisea (Pyricularia grisea)    [TaxId: 148305 ]
Cellular localisation N/D
Tissue types Conidia
Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgrLDS02
start..stop
S start..stop
GgrLDS 1287 0 44..987 34..978
AclLDS01 932 0 56..987 46..928
NfLDS01 929 0 56..987 46..928
AorLDS01 929 0 57..987 47..928
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 832031..832443 413 N° 2 832525..832765 241 N° 3 832840..833063 224 N° 4 833143..835228 2086
join(832031..832443,832525..832765,832840..833063,833143..835228)


exon

Literature and cross-references MgrLDS02
Literature Cristea,M., Osbourn,A.E. and Oliw,E.H. Linoleate diol synthase of the rice blast fungus Magnaporthe grisea. Lipids 38 (12), 1275-1280 (2003)
Protein ref. UniProtKB:   Q6UC90
DNA ref. JGI genome:   Supercontig_6.24 (832031..835228)
Cluster/Prediction ref. UniGene:   Mgr.9519
Protein sequence: MgrLDS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   987
PWM (Da):   %s   109281.87  
PI (pH):   %s   6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSSSGSSTRSSSPSDPPSSFFQKLGAFLGLFSKPQPPRPDYPHAPGNSAREEQTDITEDIQKLGFKDVETLLLYLNSSVKGVNDDKQLLLERLIQLLSKLPPTSTNGKKVTDGLITGLWESLDHPPVSSLGEKYRFREADGSNNNIHNPTLGVAGSHYARSAKPMVYQNPNPPAPETIFDTLMARDPAKFRPHPNQISSVLFYFATIITHDIFQSSRDPSINLTSSYLDLSPLYGRNLEEQLSVRAMKDGLLKPDTFCSKRVHGFPPGVGVLLIMFNRFHNYVVTSLAKINEGNRFKKPVGDDTAAWEKYDNDLFQTGRLITCGLYVNIVLVDYVRTILNLNRVDSSWILDPRTEEGKSLLSKPTPEAVGNQVSVEFNLIYRWHCGMSQRDDKWTTDMLTEALGGKDPATATLPEFFGALGRFESSFPNEPEKRTLAGLKRQEDGSFEDEGLIKIMQESIEEVAGAFGPNHVPACMRAIEILGMNQARSWNVATLNEFREFIGLKRYDTFEDINPDPKVANLLAEFYGSPDAVELYPGINAEAPKPVIVPGSGLCPPSTTGRAILSDAVTLVRGDRFFTVDYTPRNLTNFGYQEAATDKSVDNGNVIYKLFFRAFPNHYAQNSIYAHFPFVIPSENKKIMESLGLADKYSWQPPQRKPATQMIRSHAAAVKILNNQKDFKVVWGESIGFLTKFPTGENPGLGFALAGDAPANQQSRDQLMKCIFSPKAWEDEVRQFCEATTWDLLRRYSAKVQDKGPHLKVHTHEIDVIRDVISLANARFFAAVYSLPLKTENGDDGVYSDHEMYRSLMLIFSAIFWDNDVSKSFKLRRDARAATQKLGALVEKHIVEMGSLFHSFKHSHSAVSDKTNGLANGGANGHANGNANGHTNGNGIHQNGGAAPSMLRSYGDLMLRRMIEAYGEGKSVKEAVYGQIMPSIAAGTANQTQIMAQCLDYYMSDDGAEHLPEMKRLASLETPEAFNTLMK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 1 intron) and cDNA and 6 ESTs. Strain="Guy11, 70-15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCAGCAGCAGCAGCGGCAGCAGCACCAGAAGCAGCAGCCCGTCTGACCCTCCTTCCTCATTCTTCCAAAAGCTCGGGGCATTTCTTGGCTTGTTCAGCAAGCCCCAACCCCCG
CGGCCTGACTATCCTCATGCACCTGGCAACAGCGCCCGGGAAGAGCAGACAGACATCACCGAGGATATTCAGAAGCTTGGCTTCAAGGATGTGGAAACGCTTCTTCTCTACCTCAATTCT
TCAGTGAAGGGCGTCAACGATGACAAGCAGTTGCTCCTGGAGCGATTAATCCAGCTGCTGTCTAAGCTACCTCCAACCTCCACCAACGGCAAGAAGGTCACAGACGGGCTCATCACGGGA
CTGTGGGAAAGTCTGGATCATCCACCCGTGTCGAGCCTCGGAGAGAAATACCG
GTATGTGTTGTTAGGGTTGATTGTATTGACTGTAGATGTACTCTGGACGACTTGCATCTGACCCTTT
CTGCCAACTGCTAGATTCCGCGAGGCCGATGGCTCAAACAACAATATCCATAACCCAACTCTGGGAGTTGCAGGTAGCCACTATGCTAGGTCTGCCAAGCCCATGGTCTACCAAAACCCC
AACCCACCGGCGCCCGAAACCATCTTCGATACGTTGATGGCGAGAGATCCGGCCAAGTTCAGGCCACATCCGAACCAGATCTCCAGCGTTCTCTTTTACTTTGCCACAATCATTACCCAT
GACATTTTCCAGACT
GTAGGTATCCATTCAAGCCAATTATTTATTTTATTTATTCCTCATGTAATTGCTGACTTTTGTCCCTGTTCTAGTCATCGAGAGATCCTTCCATAAACTTGACCT
CATCTTACCTTGATCTCTCTCCACTCTATGGTCGGAATCTCGAGGAGCAACTGTCGGTGAGGGCAATGAAGGACGGACTGCTAAAGCCCGACACCTTTTGTTCCAAGCGAGTTCACGGGT
TTCCTCCCGGCGTTGGAGTCCTTTTGATCATGTTCAATCGGTTCCACAACTACGTTGTTACTTCACTCGCCAA
GTAAGCAAGCCTTTCAAAAATATTTTCTTACGATTTGATAGCCGATG
ACCAGTTAGTTCTAACACATTTCTGGACGCAGGATCAACGAAGGCAACCGTTTCAAGAAGCCCGTGGGAGACGACACTGCCGCATGGGAAAAGTACGACAACGACTTGTTCCAGACCGGG
CGGCTCATCACCTGCGGTCTGTACGTCAACATCGTTCTGGTTGACTACGTCCGCACGATTCTCAACCTGAACCGGGTAGACAGCAGCTGGATCCTCGACCCGCGCACCGAGGAGGGTAAG
AGTCTGCTGAGCAAACCAACCCCCGAGGCGGTAGGAAACCAGGTCTCGGTAGAGTTCAACCTCATCTACCGCTGGCACTGCGGCATGTCACAGCGTGACGACAAGTGGACCACTGATATG
TTGACCGAGGCGCTCGGCGGCAAGGACCCGGCCACAGCTACACTGCCAGAATTCTTTGGCGCGCTCGGCAGGTTCGAGTCTTCGTTTCCAAACGAGCCGGAGAAGCGCACCCTGGCTGGT
CTGAAGCGACAGGAGGACGGTTCTTTTGAGGACGAGGGCCTGATCAAGATCATGCAAGAGTCGATCGAGGAGGTTGCCGGCGCCTTTGGACCAAACCATGTCCCGGCCTGCATGCGTGCC
ATTGAGATTCTCGGCATGAACCAGGCCCGCTCTTGGAACGTCGCCACGCTGAACGAGTTCCGCGAGTTTATCGGACTAAAGCGCTACGACACATTTGAAGATATCAACCCGGACCCCAAG
GTTGCCAACCTGCTGGCCGAGTTCTACGGTTCTCCCGACGCCGTCGAGCTATACCCTGGTATCAATGCTGAAGCGCCAAAGCCTGTGATCGTCCCTGGGAGTGGCTTGTGTCCACCATCG
ACGACGGGAAGGGCAATCCTGTCCGACGCCGTGACTCTGGTCCGCGGCGACCGCTTCTTCACAGTTGACTACACCCCCAGGAACCTCACCAACTTTGGCTACCAAGAGGCCGCCACCGAT
AAGAGCGTCGACAATGGCAACGTCATTTACAAGCTTTTCTTCCGCGCTTTCCCTAACCACTACGCCCAGAACAGCATCTACGCCCACTTCCCCTTTGTGATACCCTCGGAGAACAAGAAG
ATTATGGAGAGTCTGGGTCTAGCCGACAAGTACTCGTGGCAGCCGCCGCAGCGCAAGCCAGCGACGCAGATGATCCGCTCGCACGCGGCCGCCGTCAAGATACTCAACAACCAAAAGGAC
TTCAAAGTCGTCTGGGGCGAGAGCATAGGGTTCCTGACCAAGTTCCCGACCGGAGAGAACCCGGGTTTGGGTTTTGCGCTTGCCGGCGACGCACCTGCCAACCAGCAGAGCAGGGACCAG
TTGATGAAGTGCATCTTCTCGCCCAAGGCGTGGGAGGACGAGGTGAGGCAGTTCTGCGAGGCTACGACGTGGGATCTGCTGCGGCGCTACTCGGCCAAGGTGCAGGACAAGGGACCGCAT
CTAAAGGTGCACACGCACGAGATTGATGTGATTCGCGACGTCATCAGTCTTGCCAACGCACGTTTCTTTGCCGCTGTGTACTCGCTTCCTCTCAAGACGGAGAATGGAGACGATGGCGTC
TACAGCGACCACGAAATGTACCGCTCGTTGATGCTGATCTTCTCGGCCATCTTTTGGGACAACGACGTGAGCAAGTCGTTCAAGCTCCGCCGAGACGCCCGTGCCGCGACGCAGAAGCTT
GGTGCTCTTGTTGAGAAGCACATTGTGGAGATGGGCTCGCTGTTCCACAGTTTCAAGCACTCTCATTCAGCTGTCAGTGACAAGACGAACGGGCTTGCTAATGGAGGTGCAAACGGACAT
GCGAACGGGAATGCGAATGGTCACACCAACGGCAACGGTATACATCAGAACGGTGGTGCAGCGCCGTCGATGCTGAGGAGCTACGGCGACCTCATGCTGCGCAGAATGATCGAAGCGTAT
GGAGAGGGGAAATCGGTCAAAGAGGCCGTCTATGGTCAGATCATGCCCTCCATCGCTGCCGGTACTGCCAACCAAACACAGATCATGGCGCAGTGTCTGGACTATTACATGTCTGACGAC
GGCGCTGAGCACCTCCCTGAGATGAAGCGTCTCGCGAGTCTGGAAACTCCTGAAGCCTTCAACACGTTGATGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCAGCAGCAGCAGCGGCAGCAGCACCAGAAGCAGCAGCCCGTCTGACCCTCCTTCCTCATTCTTCCAAAAGCTCGGGGCATTTCTTGGCTTGTTCAGCAAGCCCCAACCCCCG
CGGCCTGACTATCCTCATGCACCTGGCAACAGCGCCCGGGAAGAGCAGACAGACATCACCGAGGATATTCAGAAGCTTGGCTTCAAGGATGTGGAAACGCTTCTTCTCTACCTCAATTCT
TCAGTGAAGGGCGTCAACGATGACAAGCAGTTGCTCCTGGAGCGATTAATCCAGCTGCTGTCTAAGCTACCTCCAACCTCCACCAACGGCAAGAAGGTCACAGACGGGCTCATCACGGGA
CTGTGGGAAAGTCTGGATCATCCACCCGTGTCGAGCCTCGGAGAGAAATACCG
ATTCCGCGAGGCCGATGGCTCAAACAACAATATCCATAACCCAACTCTGGGAGTTGCAGGTAGCCAC
TATGCTAGGTCTGCCAAGCCCATGGTCTACCAAAACCCCAACCCACCGGCGCCCGAAACCATCTTCGATACGTTGATGGCGAGAGATCCGGCCAAGTTCAGGCCACATCCGAACCAGATC
TCCAGCGTTCTCTTTTACTTTGCCACAATCATTACCCATGACATTTTCCAGACT
TCATCGAGAGATCCTTCCATAAACTTGACCTCATCTTACCTTGATCTCTCTCCACTCTATGGTCGG
AATCTCGAGGAGCAACTGTCGGTGAGGGCAATGAAGGACGGACTGCTAAAGCCCGACACCTTTTGTTCCAAGCGAGTTCACGGGTTTCCTCCCGGCGTTGGAGTCCTTTTGATCATGTTC
AATCGGTTCCACAACTACGTTGTTACTTCACTCGCCAA
GATCAACGAAGGCAACCGTTTCAAGAAGCCCGTGGGAGACGACACTGCCGCATGGGAAAAGTACGACAACGACTTGTTCCAG
ACCGGGCGGCTCATCACCTGCGGTCTGTACGTCAACATCGTTCTGGTTGACTACGTCCGCACGATTCTCAACCTGAACCGGGTAGACAGCAGCTGGATCCTCGACCCGCGCACCGAGGAG
GGTAAGAGTCTGCTGAGCAAACCAACCCCCGAGGCGGTAGGAAACCAGGTCTCGGTAGAGTTCAACCTCATCTACCGCTGGCACTGCGGCATGTCACAGCGTGACGACAAGTGGACCACT
GATATGTTGACCGAGGCGCTCGGCGGCAAGGACCCGGCCACAGCTACACTGCCAGAATTCTTTGGCGCGCTCGGCAGGTTCGAGTCTTCGTTTCCAAACGAGCCGGAGAAGCGCACCCTG
GCTGGTCTGAAGCGACAGGAGGACGGTTCTTTTGAGGACGAGGGCCTGATCAAGATCATGCAAGAGTCGATCGAGGAGGTTGCCGGCGCCTTTGGACCAAACCATGTCCCGGCCTGCATG
CGTGCCATTGAGATTCTCGGCATGAACCAGGCCCGCTCTTGGAACGTCGCCACGCTGAACGAGTTCCGCGAGTTTATCGGACTAAAGCGCTACGACACATTTGAAGATATCAACCCGGAC
CCCAAGGTTGCCAACCTGCTGGCCGAGTTCTACGGTTCTCCCGACGCCGTCGAGCTATACCCTGGTATCAATGCTGAAGCGCCAAAGCCTGTGATCGTCCCTGGGAGTGGCTTGTGTCCA
CCATCGACGACGGGAAGGGCAATCCTGTCCGACGCCGTGACTCTGGTCCGCGGCGACCGCTTCTTCACAGTTGACTACACCCCCAGGAACCTCACCAACTTTGGCTACCAAGAGGCCGCC
ACCGATAAGAGCGTCGACAATGGCAACGTCATTTACAAGCTTTTCTTCCGCGCTTTCCCTAACCACTACGCCCAGAACAGCATCTACGCCCACTTCCCCTTTGTGATACCCTCGGAGAAC
AAGAAGATTATGGAGAGTCTGGGTCTAGCCGACAAGTACTCGTGGCAGCCGCCGCAGCGCAAGCCAGCGACGCAGATGATCCGCTCGCACGCGGCCGCCGTCAAGATACTCAACAACCAA
AAGGACTTCAAAGTCGTCTGGGGCGAGAGCATAGGGTTCCTGACCAAGTTCCCGACCGGAGAGAACCCGGGTTTGGGTTTTGCGCTTGCCGGCGACGCACCTGCCAACCAGCAGAGCAGG
GACCAGTTGATGAAGTGCATCTTCTCGCCCAAGGCGTGGGAGGACGAGGTGAGGCAGTTCTGCGAGGCTACGACGTGGGATCTGCTGCGGCGCTACTCGGCCAAGGTGCAGGACAAGGGA
CCGCATCTAAAGGTGCACACGCACGAGATTGATGTGATTCGCGACGTCATCAGTCTTGCCAACGCACGTTTCTTTGCCGCTGTGTACTCGCTTCCTCTCAAGACGGAGAATGGAGACGAT
GGCGTCTACAGCGACCACGAAATGTACCGCTCGTTGATGCTGATCTTCTCGGCCATCTTTTGGGACAACGACGTGAGCAAGTCGTTCAAGCTCCGCCGAGACGCCCGTGCCGCGACGCAG
AAGCTTGGTGCTCTTGTTGAGAAGCACATTGTGGAGATGGGCTCGCTGTTCCACAGTTTCAAGCACTCTCATTCAGCTGTCAGTGACAAGACGAACGGGCTTGCTAATGGAGGTGCAAAC
GGACATGCGAACGGGAATGCGAATGGTCACACCAACGGCAACGGTATACATCAGAACGGTGGTGCAGCGCCGTCGATGCTGAGGAGCTACGGCGACCTCATGCTGCGCAGAATGATCGAA
GCGTATGGAGAGGGGAAATCGGTCAAAGAGGCCGTCTATGGTCAGATCATGCCCTCCATCGCTGCCGGTACTGCCAACCAAACACAGATCATGGCGCAGTGTCTGGACTATTACATGTCT
GACGACGGCGCTGAGCACCTCCCTGAGATGAAGCGTCTCGCGAGTCTGGAAACTCCTGAAGCCTTCAACACGTTGATGAAGTAG

Retrieve as FASTA