Entry information : GzHalPrx01
Entry ID 4188
Creation 2007-01-26 (Filippo Passardi)
Last sequence changes 2007-01-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzHalPrx01
Name GzHalPrx01
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzHalPrx01
start..stop
S start..stop
AniHalPrx01 386 2e-137 1..264 1..262
AteHalPrx01 382 3e-136 30..264 7..240
PnoHalPrx01 333 2e-116 1..266 1..266
AnHalPrx01 202 4e-65 1..249 1..243
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7528509..7528635 127 N° 2 7528197..7528440 244 N° 3 7527867..7528138 272 N° 4 7527642..7527799 158
complement(join(7527642..7527799,7527867..7528138,7528197..7528440,7528509..7528 635))


exon

Literature and cross-references GzHalPrx01
Literature Birren B.W. et al. Fusarium graminearum genome sequence. unpublished
Protein ref. UniProtKB_Uniparc:   Q4IKB7
DNA ref. JGI genome:   Supercontig_3.1 (7528635..7527642)
Protein sequence: GzHalPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   266 (248)
PWM (Da):   %s   29543.81 (27745.9)  
PI (pH):   %s   6.69 (6.37) Peptide Signal:   %s   cut: 29 range:19-266
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFSTLIAASGTVATTFALPQFLPTAGAEWTPQEWVAPGANDSRGPCPGLNTLANHGYLPHDGKNIDLKKLADGMLAGFNIEKGDALLLFTQAIRTSPDYPSTRTFDLADLGRHNILEHDISISRSDAFFADPNPFNKTVWAETLTYFPDDMITVEQVAKARMGRLATSKKTNPQHSLSKLADGFSWGEMASFFEIMADGTTGTVEKKYIEYWKNERLPTEIGWQRRTTTMRGIERIEFTRRLMEAAGVSRRDITSDAYGRPLEQ

Retrieve as FASTA  
Remarks Complete sequence from Genomic (Chromo 1, 3 introns). Strain="PH-1/NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCTCTACCTTGATTGCTGCCTCTGGTACCGTTGCGACCACCTTCGCTCTCCCTCAGTTTCTACCCACGGCTGGTGCCGAGTGGACTCCTCAAGAATGGGTTGCTCCTGGCGCA
AATGACT
GTAAGTTCCCATAGTCTAATTGAACTCCAGCGGTCTCCTTATCTCCAATATCTAACTGCTTCATGAAGCTCGTGGTCCTTGCCCTGGTCTTAACACATTGGCCAACCATGGCT
ACCTTCCCCATGACGGAAAGAACATCGATCTGAAGAAACTTGCCGATGGAATGCTTGCTGGTTTCAACATCGAGAAGGGTGATGCTCTCCTTCTCTTCACCCAGGCCATCAGGACAAGCC
CTGACTATCCTTCAACCCGTACTTTCGATCTAGCGGATCTTGGTCGTCACAATATCCTCGAGCACGATATTTCCATCAG
GTATGCCATAGCTAAACCTCTATTTATTCATCATCCATCTC
TAACAGACCTTTTGTAGTCGCTCGGACGCTTTCTTTGCTGACCCAAACCCCTTCAACAAAACTGTTTGGGCCGAGACCCTAACATACTTCCCCGACGACATGATCACCGTCGAGCAAGTT
GCGAAAGCACGAATGGGTCGTCTTGCAACCTCGAAGAAGACCAACCCCCAGCACTCGCTGTCTAAGTTGGCTGACGGCTTCAGCTGGGGCGAGATGGCTTCTTTCTTTGAGATCATGGCT
GATGGTACTACCGGCACGGTAGAGAAGAAGTACATCGAGTACTGGTTTA
GTATGTCACTTTGCGTTTCATGCGTTGGCATCCCTTCAAACAAGGCTAACAAAGACTTCTACTACAGAGAA
TGAGCGTCTGCCTACAGAAATTGGATGGCAGCGACGAACCACAACCATGCGCGGTATTGAGCGCATCGAGTTCACTAGAAGGCTCATGGAGGCTGCTGGCGTTTCCCGCCGTGATATCAC
CAGTGATGCTTATGGTCGCCCGCTGGAACAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCTCTACCTTGATTGCTGCCTCTGGTACCGTTGCGACCACCTTCGCTCTCCCTCAGTTTCTACCCACGGCTGGTGCCGAGTGGACTCCTCAAGAATGGGTTGCTCCTGGCGCA
AATGACT
CTCGTGGTCCTTGCCCTGGTCTTAACACATTGGCCAACCATGGCTACCTTCCCCATGACGGAAAGAACATCGATCTGAAGAAACTTGCCGATGGAATGCTTGCTGGTTTCAAC
ATCGAGAAGGGTGATGCTCTCCTTCTCTTCACCCAGGCCATCAGGACAAGCCCTGACTATCCTTCAACCCGTACTTTCGATCTAGCGGATCTTGGTCGTCACAATATCCTCGAGCACGAT
ATTTCCATCAG
TCGCTCGGACGCTTTCTTTGCTGACCCAAACCCCTTCAACAAAACTGTTTGGGCCGAGACCCTAACATACTTCCCCGACGACATGATCACCGTCGAGCAAGTTGCGAAA
GCACGAATGGGTCGTCTTGCAACCTCGAAGAAGACCAACCCCCAGCACTCGCTGTCTAAGTTGGCTGACGGCTTCAGCTGGGGCGAGATGGCTTCTTTCTTTGAGATCATGGCTGATGGT
ACTACCGGCACGGTAGAGAAGAAGTACATCGAGTACTGGTTTA
AGAATGAGCGTCTGCCTACAGAAATTGGATGGCAGCGACGAACCACAACCATGCGCGGTATTGAGCGCATCGAGTTC
ACTAGAAGGCTCATGGAGGCTGCTGGCGTTTCCCGCCGTGATATCACCAGTGATGCTTATGGTCGCCCGCTGGAACAGTAA

Retrieve as FASTA