Entry information : TaPrx01-1A (TAPOX1 / TaPrx01-1A)
Entry ID 42
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-06-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-18 (Christophe Dunand)
Peroxidase information: TaPrx01-1A (TAPOX1 / TaPrx01-1A)
Name (synonym) TaPrx01-1A (TAPOX1 / TaPrx01-1A)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Triticum
Organism Triticum aestivum (bread wheat)    [TaxId: 4565 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TaPrx01-1A
start..stop
S start..stop
AvePrx111-1E_H938 639 0 1..316 1..316
AvePrx111-1A_H938 605 0 1..316 1..316
TaPrx01-1B 605 0 1..316 1..316
AvePrx111-1L_H938 597 0 1..316 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 220..423 204 N° 2 512..703 192 N° 3 814..979 166 N° 4 1082..1470 389
join(220..423,512..703,814..979,1082..1470)


exon

Literature and cross-references TaPrx01-1A (TAPOX1 / TaPrx01-1A)
Literature Baga,M., Chibbar,R.N. and Kartha,K.K. Molecular cloning and expression analysis of peroxidase genes from wheat. Plant Mol. Biol. 29 (4), 647-662 (1995)
Protein ref. UniProtKB:   Q41577
DNA ref. GenBank:   X85227.1
Protein sequence: TaPrx01-1A (TAPOX1 / TaPrx01-1A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (295)
PWM (Da):   %s   33068.2 (31111.2)  
PI (pH):   %s   6.49 (6.10) Peptide Signal:   %s   cut: 22 range:22-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRLGLVVLVAMASAASAQLSSTFYDTSCPNALATIKAGVTTAVQNEARMGASLVRLHFHDCFVDGCDGSVLLADTGSFIGEQGAAPNNNSIRGMNVIDNIKTQVEAVCKQTVSCADILAVAARDSVVALGGPTWTVLLGRRDSTTASKTNAENDLPPPTFDLQNLTTLFGNKQLSMTDMVALSGAHTIGQSQCRFFRDRIYNETNINTTFATSLRANCPQSGGDSSLAPLDTQTPNGFDNAYYTNLMSQKGLLHSDQVLFNGGGADNTVRSFSSSAATFNSAFTTAMVNMGNIAPKTGTQGQIRLVCSKVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). cultivar="Biggar"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCCTCTCGCCTTGGCTTAGTGGTGCTCGTGGCAATGGCCTCGGCGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCTTGCCCCAACGCGCTGGCCACCATCAAG
GCCGGCGTGACGACCGCCGTGCAAAACGAGGCCCGCATGGGGGCGTCGCTCGTCCGGCTGCACTTCCACGACTGCTTTGTCGAT
GCAAGTCCCATAACCTTACTCACGTGGGAGTACGCT
GTAAAAGACGTTAGTACACGCAAATGATTAGTGTTTCTGAATTTCTTTCCAGGGATGTGACGGGTCCGTTCTATTGGCGGACACGGGGAGCTTCATCGGCGAGCAGGGGGCAGCCCCGAA
CAACAATTCCATTCGAGGCATGAACGTCATCGACAACATCAAAACTCAGGTGGAGGCCGTGTGCAAGCAGACCGTTTCCTGCGCCGACATCCTCGCCGTCGCCGCGCGTGACTCCGTCGT
CGCG
GTAAGCTCGGCAATTACTAGCTCTCATGCACGTACTGGTGCTGCCGGACCAGCGACGCCCCCATAACTAACTGAGGTTTGGAACTAATTCTGGACATACTTACCAAGCAGCTGGGT
GGGCCGACATGGACTGTTCTTCTTGGGAGGAGGGACTCCACCACTGCAAGCAAGACCAACGCGGAAAATGACCTGCCACCTCCTACCTTCGACCTCCAAAACCTCACCACCTTGTTCGGC
AACAAGCAGCTCAGCATGACAGACATGGTTGCGCTCTCAG
GTACACCCCGCTAATATCTATGCATGAGTTCTCTGAGCTCAAACTTCACCACAGCAACTCGCGAGAGATATTCTGACACA
AATATGCTTGATCTACCTGCAGGTGCCCACACGATCGGGCAATCGCAGTGCCGGTTTTTCAGGGACAGGATCTACAACGAGACCAACATCAACACCACCTTCGCGACATCTCTCAGGGCC
AACTGCCCCCAGTCCGGCGGTGACAGCAGCCTGGCGCCGCTGGACACGCAGACGCCCAACGGCTTCGACAACGCCTACTACACCAACCTCATGTCCCAGAAGGGGCTCCTGCACTCGGAC
CAGGTGCTGTTCAACGGCGGCGGCGCCGACAACACGGTCAGGAGCTTCTCGTCCAGCGCGGCGACGTTCAACAGCGCCTTCACAACGGCCATGGTAAACATGGGGAACATCGCGCCAAAG
ACGGGGACGCAGGGGCAGATCAGGCTCGTCTGCTCCAAGGTCAACTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCCTCTCGCCTTGGCTTAGTGGTGCTCGTGGCAATGGCCTCGGCGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCTTGCCCCAACGCGCTGGCCACCATCAAG
GCCGGCGTGACGACCGCCGTGCAAAACGAGGCCCGCATGGGGGCGTCGCTCGTCCGGCTGCACTTCCACGACTGCTTTGTCGAT
GGATGTGACGGGTCCGTTCTATTGGCGGACACGGGG
AGCTTCATCGGCGAGCAGGGGGCAGCCCCGAACAACAATTCCATTCGAGGCATGAACGTCATCGACAACATCAAAACTCAGGTGGAGGCCGTGTGCAAGCAGACCGTTTCCTGCGCCGAC
ATCCTCGCCGTCGCCGCGCGTGACTCCGTCGTCGCG
CTGGGTGGGCCGACATGGACTGTTCTTCTTGGGAGGAGGGACTCCACCACTGCAAGCAAGACCAACGCGGAAAATGACCTGCCA
CCTCCTACCTTCGACCTCCAAAACCTCACCACCTTGTTCGGCAACAAGCAGCTCAGCATGACAGACATGGTTGCGCTCTCAG
GTGCCCACACGATCGGGCAATCGCAGTGCCGGTTTTTC
AGGGACAGGATCTACAACGAGACCAACATCAACACCACCTTCGCGACATCTCTCAGGGCCAACTGCCCCCAGTCCGGCGGTGACAGCAGCCTGGCGCCGCTGGACACGCAGACGCCCAAC
GGCTTCGACAACGCCTACTACACCAACCTCATGTCCCAGAAGGGGCTCCTGCACTCGGACCAGGTGCTGTTCAACGGCGGCGGCGCCGACAACACGGTCAGGAGCTTCTCGTCCAGCGCG
GCGACGTTCAACAGCGCCTTCACAACGGCCATGGTAAACATGGGGAACATCGCGCCAAAGACGGGGACGCAGGGGCAGATCAGGCTCGTCTGCTCCAAGGTCAACTCGTAA

Retrieve as FASTA