Entry information : GzHalPrx04
Entry ID 4227
Creation 2007-01-26 (Filippo Passardi)
Last sequence changes 2007-01-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzHalPrx04
Name GzHalPrx04
Class Haloperoxidase (haem)    [Orthogroup: HalPrx002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzHalPrx04
start..stop
S start..stop
AteHalPrx03 314 2e-103 25..398 42..421
PnoHalPrx10 275 1e-88 14..414 24..416
AfumHalPrx02 275 3e-88 50..401 70..416
PnoHalPrx09 259 7e-83 42..416 65..410
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43199..43228 30 N° 2 41843..43159 1317  
complement(join(41843..43159,43199..43228))


exon

Literature and cross-references GzHalPrx04
Literature Birren B. et al.

Fusarium graminearum genome sequence

Unpublished
DNA sequence http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=30475334&itemID=79&view=gbwithparts
Protein ref. GenPept:   42552593 UniProtKB_Uniparc:   Q4HUY2
DNA ref. JGI genome:   Supercontig_3.8 (43228..41843)
Protein sequence: GzHalPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   448
PWM (Da):   %s   48834.57  
PI (pH):   %s   8.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKIALSTWLTLSPEQLDAYRQHAERAPEACPFAQKEKRATTFDAKKQLISVSGLHAFRAPQAGDERGPCPGLNALANHGYLPHNGVADMQTIIQATNEVYGMSLDLGGFLAVYGTVINGNPLSTSPGYSIGGPSRFSQNILNGGGILGTPSGLSGSHNKYESDASSTRGDLYVTGNNFHLILSRFEEYWRAIKPNTPAPKQYTALAPFHYKQFQDSEKTNSHFFYSPFAGVLVSPSGYSFPPRMMANHSNEYPEGYLSREVFTTFFGVKGDKPGNFKVNQGWERIPENWYRRPVDDEFSINDFLIDVLEHAAKYPRLLNIGGNTGKVNSFAGVDIGDLTGGVFNTAGLLKPDNLECFAMQIIMAAAPDFIGSQFTDVKKALTPLSDKLRQLLAGKTCPKLQKYNHKLFAKYPGYTEPYGSYAGVSKGSLKGIIETTKGILGGLWPTGK*

Retrieve as FASTA  
Remarks Complete sequence from Genomic (Chromo 3 and 2 exons). Strain="PH-1/NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCGCATTATCTACATGGCTCACAGTAGCCTGACTTCTCCCTTCAACCTTTGCCTTTCCACAGCTCAGTCCTGAACAGCTCGATGCATATCGCCAACACGCTGAAAGAGCACCT
GAAGCTTGCCCATTCGCGCAGAAGGAGAAACGAGCTACTACATTCGATGCCAAGAAGCAACTCATCAGCGTCAGTGGTCTGCATGCCTTCCGTGCGCCCCAGGCCGGTGATGAGCGAGGT
CCTTGTCCGGGTCTGAATGCTCTCGCCAATCACGGATACTTGCCTCATAATGGAGTCGCAGACATGCAGACCATTATCCAAGCCACAAACGAAGTCTACGGAATGAGCCTTGACCTTGGT
GGTTTCCTGGCTGTCTATGGCACCGTAATCAATGGCAATCCACTCTCGACCAGTCCTGGCTACTCCATTGGTGGCCCCAGTCGCTTTAGCCAAAACATTCTCAACGGGGGCGGCATTCTC
GGTACTCCTTCCGGCCTCAGTGGTAGCCACAACAAGTACGAGAGTGATGCCAGCTCCACTCGTGGTGATCTCTACGTGACCGGCAATAACTTTCACCTCATTCTTAGTCGCTTTGAAGAA
TACTGGCGCGCCATCAAACCCAACACGCCTGCTCCAAAACAATACACCGCCCTGGCGCCATTCCACTATAAACAATTCCAGGACTCGGAGAAAACCAACAGCCACTTCTTCTACTCGCCT
TTCGCTGGAGTCTTGGTCTCACCTTCTGGGTATTCATTCCCTCCGCGAATGATGGCCAACCACTCAAATGAGTACCCCGAGGGATATCTCTCTCGTGAAGTCTTTACCACCTTTTTTGGT
GTCAAGGGAGATAAACCTGGCAACTTCAAAGTGAACCAGGGATGGGAGCGCATTCCCGAAAACTGGTACCGCCGCCCGGTAGACGATGAGTTCTCCATCAATGACTTCCTTATTGATGTT
CTCGAACACGCGGCCAAGTACCCTCGTCTCTTGAACATTGGTGGAAACACCGGCAAGGTCAATAGCTTCGCTGGTGTGGACATTGGCGACCTAACCGGTGGTGTCTTCAACACAGCTGGA
CTTCTCAAGCCTGACAATCTCGAGTGCTTTGCCATGCAGATAATAATGGCTGCTGCACCTGATTTTATTGGAAGCCAGTTCACTGATGTCAAGAAGGCGTTGACACCACTGAGCGATAAG
CTTCGCCAGCTTCTCGCGGGCAAGACATGCCCCAAGCTCCAAAAGTATAACCATAAGCTGTTTGCCAAGTACCCTGGCTACACTGAGCCTTATGGCAGTTACGCTGGTGTTTCCAAGGGT
TCACTCAAGGGTATTATTGAGACGACCAAGGGCATTCTGGGAGGACTTTGGCCAACTGGCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCGCATTATCTACATGGCTCACACTCAGTCCTGAACAGCTCGATGCATATCGCCAACACGCTGAAAGAGCACCTGAAGCTTGCCCATTCGCGCAGAAGGAGAAACGAGCTACT
ACATTCGATGCCAAGAAGCAACTCATCAGCGTCAGTGGTCTGCATGCCTTCCGTGCGCCCCAGGCCGGTGATGAGCGAGGTCCTTGTCCGGGTCTGAATGCTCTCGCCAATCACGGATAC
TTGCCTCATAATGGAGTCGCAGACATGCAGACCATTATCCAAGCCACAAACGAAGTCTACGGAATGAGCCTTGACCTTGGTGGTTTCCTGGCTGTCTATGGCACCGTAATCAATGGCAAT
CCACTCTCGACCAGTCCTGGCTACTCCATTGGTGGCCCCAGTCGCTTTAGCCAAAACATTCTCAACGGGGGCGGCATTCTCGGTACTCCTTCCGGCCTCAGTGGTAGCCACAACAAGTAC
GAGAGTGATGCCAGCTCCACTCGTGGTGATCTCTACGTGACCGGCAATAACTTTCACCTCATTCTTAGTCGCTTTGAAGAATACTGGCGCGCCATCAAACCCAACACGCCTGCTCCAAAA
CAATACACCGCCCTGGCGCCATTCCACTATAAACAATTCCAGGACTCGGAGAAAACCAACAGCCACTTCTTCTACTCGCCTTTCGCTGGAGTCTTGGTCTCACCTTCTGGGTATTCATTC
CCTCCGCGAATGATGGCCAACCACTCAAATGAGTACCCCGAGGGATATCTCTCTCGTGAAGTCTTTACCACCTTTTTTGGTGTCAAGGGAGATAAACCTGGCAACTTCAAAGTGAACCAG
GGATGGGAGCGCATTCCCGAAAACTGGTACCGCCGCCCGGTAGACGATGAGTTCTCCATCAATGACTTCCTTATTGATGTTCTCGAACACGCGGCCAAGTACCCTCGTCTCTTGAACATT
GGTGGAAACACCGGCAAGGTCAATAGCTTCGCTGGTGTGGACATTGGCGACCTAACCGGTGGTGTCTTCAACACAGCTGGACTTCTCAAGCCTGACAATCTCGAGTGCTTTGCCATGCAG
ATAATAATGGCTGCTGCACCTGATTTTATTGGAAGCCAGTTCACTGATGTCAAGAAGGCGTTGACACCACTGAGCGATAAGCTTCGCCAGCTTCTCGCGGGCAAGACATGCCCCAAGCTC
CAAAAGTATAACCATAAGCTGTTTGCCAAGTACCCTGGCTACACTGAGCCTTATGGCAGTTACGCTGGTGTTTCCAAGGGTTCACTCAAGGGTATTATTGAGACGACCAAGGGCATTCTG
GGAGGACTTTGGCCAACTGGCAAGTAG

Retrieve as FASTA