Entry information : GmPrx05 (Glyma15g05820.1)
Entry ID 424
Creation 2006-01-17 (Christophe Dunand)
Last sequence changes 2006-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx05 (Glyma15g05820.1)
Name (synonym) GmPrx05 (Glyma15g05820.1)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Germinating shoots
Roots
Seedling epicotyls
Seedlings
Inducers Cyst nematode infection
Nodulation
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx05
start..stop
S start..stop
GmPrx170 617 0 1..325 1..325
GmPrx256 566 0 1..325 1..322
PvPrx04 558 0 1..325 1..325
LjPrx07 543 0 3..325 2..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4130128..4130523 396 N° 2 4129780..4129942 163 N° 3 4128840..4129258 419  
complement(join(4128840..4129258,4129780..4129942,4130128..4130523))


exon

Literature and cross-references GmPrx05 (Glyma15g05820.1)
Literature Wang,G et al unpublished.
DNA ref. Phytozome 11:   Gm15 (4130523..4128840)
Protein sequence: GmPrx05 (Glyma15g05820.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   34730.69 (32048.2)  
PI (pH):   %s   7.99 (7.98) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEERSLYSLVFLVLALAIVNKVHGQGTRVGFYSSTCPRAESIVKSTVTTHVNSDSTLAAGLLRMHFHDCFVQGCDASVLIAGSGTERTAFANLGLRGFEVIDDAKKQLEAACPGVVSCADILALAARDSVVLSGGLSYQVLTGRRDGRISQASDVSNLPAPFDSVDVQKQKFTAKGLNTQDLVTLVGAHTIGTTACQFFSNRLYNFTANGPDPSIDPSFLSQLQSLCPQNGDGSKRVALDTGSQTKFDLSYYSNLRNSRGILQSDQALWSDASTKTTVQRYLGLIRGLLGLTFNVEFGKSMVKMGNIELKTGTDGEIRKICSAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3) and 27 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGAACGTAGTTTGTACTCACTAGTGTTTCTTGTGCTTGCTTTGGCTATTGTGAACAAAGTGCATGGGCAAGGGACGCGTGTAGGGTTCTATTCGAGTACATGCCCACGCGCTGAG
TCCATTGTTAAGTCCACAGTTACAACCCATGTTAATTCTGATAGTACTTTGGCTGCTGGGTTGCTTCGGATGCACTTCCATGATTGCTTTGTGCAAGGTTGTGACGCTTCTGTTCTCATT
GCCGGTTCTGGCACTGAGAGAACAGCATTTGCAAACCTTGGTTTACGAGGATTTGAGGTTATTGATGATGCAAAGAAACAGCTCGAGGCTGCATGCCCCGGTGTTGTGTCTTGCGCTGAT
ATCCTTGCTCTTGCTGCTCGTGATTCCGTTGTTCTG
GTAATTCATCAACACTCAAATTCTATCCATTTTGAATTTATATATGTACTACAAATAATTAATATTATAGCCAAGTTGATGAGT
TCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAATTAAAATTTGGCATTTTTGCATGGCAGAGTGGTGGACTGAGTTATC
AAGTGCTTACTGGACGCAGAGATGGACGCATATCACAGGCTTCCGACGTGAGTAACTTGCCTGCTCCTTTTGACTCTGTTGATGTTCAGAAACAAAAGTTCACAGCAAAGGGCCTCAACA
CTCAAGACCTCGTCACCCTTGTTG
GTAATTACACTTACACATATATAAGTTTGTTTACACACTTCAAGTCAACGATCGAATTGATCATCATTTCAAATCGAACTCATACTTTTCACATAG
TATATATCACGGTTGCTTTGTGACAGCTCAGTTCTAACTATAGGTAGTGGCAAAATGCAAATAGAATGACTTCACATTAACTTTAATATAATTGTTGACTTATTCACTTTTTATTACACT
TTCTTATATATGTAACGCACATTAGAATAACATCTTCTTTCTTTCTTATTTTCTATCATTGTCAAGTGATATGACATTTTTTTAAAAGGATACGTGTTTGAAAAAAAATTGAACAATGCT
TTTCAATGGATATTATAAAAAGGTACAAACAAAAGTGCCGTGGAAAAATCAACACTAAAATTAACTTCATACGACTATATCTTTTATGAAAACAAAAGTATATGTTATATGAAACTAAGA
TACAGGTTCACAATACAAAGTTGAATTAATGGATTTTATTTTTGTTAACTAATGTATATATATAGGTGCACATACCATTGGTACTACAGCTTGCCAGTTCTTCAGTAACAGATTGTACAA
CTTCACCGCGAATGGTCCTGACCCTTCCATCGACCCTTCATTTCTTTCCCAACTACAATCACTATGCCCTCAAAACGGTGACGGTTCAAAACGAGTAGCGCTAGATACGGGTAGTCAAAC
CAAATTTGATTTATCTTACTATAGTAATTTGAGGAATTCTCGTGGAATTCTGCAATCTGATCAAGCACTATGGAGTGATGCTTCCACAAAGACAACTGTTCAGAGGTACTTGGGCTTAAT
AAGAGGGTTACTTGGATTAACATTCAACGTGGAATTTGGGAAGTCTATGGTGAAAATGGGCAACATTGAGTTGAAAACCGGTACCGATGGTGAAATTCGCAAGATATGTTCTGCCATCAA
CTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGAACGTAGTTTGTACTCACTAGTGTTTCTTGTGCTTGCTTTGGCTATTGTGAACAAAGTGCATGGGCAAGGGACGCGTGTAGGGTTCTATTCGAGTACATGCCCACGCGCTGAG
TCCATTGTTAAGTCCACAGTTACAACCCATGTTAATTCTGATAGTACTTTGGCTGCTGGGTTGCTTCGGATGCACTTCCATGATTGCTTTGTGCAAGGTTGTGACGCTTCTGTTCTCATT
GCCGGTTCTGGCACTGAGAGAACAGCATTTGCAAACCTTGGTTTACGAGGATTTGAGGTTATTGATGATGCAAAGAAACAGCTCGAGGCTGCATGCCCCGGTGTTGTGTCTTGCGCTGAT
ATCCTTGCTCTTGCTGCTCGTGATTCCGTTGTTCTG
AGTGGTGGACTGAGTTATCAAGTGCTTACTGGACGCAGAGATGGACGCATATCACAGGCTTCCGACGTGAGTAACTTGCCTGCT
CCTTTTGACTCTGTTGATGTTCAGAAACAAAAGTTCACAGCAAAGGGCCTCAACACTCAAGACCTCGTCACCCTTGTTG
GTGCACATACCATTGGTACTACAGCTTGCCAGTTCTTCAGT
AACAGATTGTACAACTTCACCGCGAATGGTCCTGACCCTTCCATCGACCCTTCATTTCTTTCCCAACTACAATCACTATGCCCTCAAAACGGTGACGGTTCAAAACGAGTAGCGCTAGAT
ACGGGTAGTCAAACCAAATTTGATTTATCTTACTATAGTAATTTGAGGAATTCTCGTGGAATTCTGCAATCTGATCAAGCACTATGGAGTGATGCTTCCACAAAGACAACTGTTCAGAGG
TACTTGGGCTTAATAAGAGGGTTACTTGGATTAACATTCAACGTGGAATTTGGGAAGTCTATGGTGAAAATGGGCAACATTGAGTTGAAAACCGGTACCGATGGTGAAATTCGCAAGATA
TGTTCTGCCATCAACTAG

Retrieve as FASTA