Entry information : TcasPxt01
Entry ID 4263
Creation 2006-12-28 (Marcel Zamocky)
Last sequence changes 2016-01-22 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-22 (Christophe Dunand)
Peroxidase information: TcasPxt01
Name TcasPxt01
Class Invertebrate peroxinectin    [Orthogroup: Pxt001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Tenebrionidae Tribolium
Organism Tribolium castaneum    [TaxId: 7070 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TcasPxt01
start..stop
S start..stop
AmelPxt02 764 0 71..629 92..654
DmPxt02-A 744 0 34..661 53..688
AaePxt03_Liverpool 745 0 71..652 118..704
AaePxt03_Rockfella 739 0 71..652 82..668
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..146 146 N° 2 200..399 200 N° 3 589..765 177 N° 4 818..1014 197
N° 5 1066..1261 196 N° 6 1313..1658 346 N° 7 2070..2226 157 N° 8 2279..2449 171
N° 9 2506..2698 193 N° 10 2748..2853 106 N° 11 2923..3055 133  
join(1..146,200..399,589..765,818..1014,1066..1261,1313..1658,2070..2226,2279..2 449,2506..2698,2748..2853,2923..3055)


exon

Literature and cross-references TcasPxt01
Literature Kim,H.S et al., BeetleBase in 2010: revisions to provide comprehensive genomic information for Tribolium castaneum. Nucleic Acids Res. 38 (DATABASE ISSUE), D437-D442 (2010)
Protein ref. GenBank:   XP_967241.1
DNA ref. GenBank:   NW_001092786.1 (49570..52624)
Protein sequence: TcasPxt01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   673 (660)
PWM (Da):   %s   75793.43 (74220.6)  
PI (pH):   %s   5.63 (5.54) Peptide Signal:   %s   cut: 14 range:14-673
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWYFLALLHLTLAEPKGSGYSIFLEHTPSWDRRPYGYGPAAPVAFDPFNNNNFLPQPQPQPPTPDPATLGCGTPPAGCPKSRYRSYDGSCNNLGNPILGTPQTRYARLLPANYAGVSTPTASVTGKPLPGSRIVSLLIYPDVQIEDPKFTINAMQYGQIITHDMSMIAGSTQAQPHQTKCCTADGQLLEFANIPEHCFPIVLPNDDPAHSQTNAKCMNFVRTITDRDRNCVGGSQPAELTAVNHYLDLSIVYGNSDQINQQVRQFQGGRLRVEVRDGKEWLPRSTNASGVCSIQSPQEVCYLAGDARVNQNPQLTILQIILMREHNRIADALAKLNPHWDDETIFQEARRIAIAEHQFISYYEWLPIFIGIENSLKNKIIYLSKHFINDYRQEVDPTVLNEHATAAFRYFHSLIAGHLDLVNEHRSSYGNLRLSDWFNRPAIVEQGDNFDELTRGLATQPELASDPYHDSEITQFLFRDGQQFGSDLKAIDIQRNRDHGLASYNEYRGFCGLPRAHSFEDFLDVMTQNVKKLATLYESPDDVDLTVGGSLEAHVPGTLSGPTFLCILTEQFYRTRVGDRFWFENQHNGFTLAQLNAIRKTSISRLLCDNGHHIQAMQPRGFERISHDNPITPCENLPAVDLTLWKEVPFGVERPYDFGSDFSDEFFWKKK

Retrieve as FASTA  
Remarks Complete sequence from genomic and 3 ESTs. Original annotation PREDICTED: similar to Peroxidase precursor (DmPO)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTACTTCCTGGCCCTTCTCCACTTGACCTTAGCTGAACCCAAAGGCTCGGGTTATAGCATTTTCCTCGAACACACGCCAAGTTGGGACAGGAGACCTTACGGTTACGGACCTGCG
GCACCAGTGGCCTTTGACCCTTTCAA
GTACTACCCTCCAATACCCCAAAAAACGCACTTTATACAAATACTCTTTGTAGCAATAACAATTTCTTGCCACAACCACAACCACAACCCCCAA
CACCCGATCCGGCAACCTTAGGCTGTGGTACCCCACCAGCAGGGTGCCCCAAATCGAGGTACCGCTCCTACGATGGTTCCTGTAATAACTTAGGGAACCCAATTTTGGGTACTCCACAGA
CACGATACGCGAGGCTTCTACCGGCGAATTACGCCGATG
GTAAGTAATTTAAAATGTTGGTAAGGGGTGCACTAATTTAACAGAAAAAGTCAGTCTGTTTTGAGAAAAAACAATTAGCTG
ACAAAATCAATATGAATGTTTCAGAAAAATCGGTTTTACACCACAAAAATAATAAAATGTTTGTGAACACTGGTTATTTTTCTAACTTCGTTGGTTGTTTTTTTTTAGGGGTGAGCACCC
CCACAGCTTCAGTAACGGGAAAACCGCTCCCAGGCTCTCGAATAGTCAGTCTTTTGATTTATCCCGATGTACAAATTGAAGATCCCAAATTTACAATTAATGCCATGCAATATGGGCAAA
TAATCACCCATGATATGAGCATGATTGCGGGAAGTACCCAAGCAC
GTAAGTGTCGCTTTTTTTCCAACTTGTTGAGTGTTGTAAATGAGTGTTTTAGAGCCCCATCAGACCAAGTGTTGT
ACGGCCGATGGTCAATTGCTCGAGTTTGCCAACATACCGGAACATTGTTTCCCTATAGTGTTGCCCAACGATGACCCCGCTCACTCCCAGACGAATGCAAAGTGCATGAATTTTGTAAGA
ACGATCACTGATCGTGATCGCAACTGTGTTGGAGGCTCACAACCGGCTGAACAA
GTACTTAATTTTATTTTCCACTTAACCTATCATGCAATCATATTTTAACAGTTAACTGCAGTTAAC
CATTACTTGGACTTATCGATAGTTTACGGTAACAGCGACCAAATCAACCAACAAGTCCGGCAATTCCAAGGCGGAAGACTTAGAGTTGAAGTACGAGATGGGAAAGAATGGTTACCGAGG
AGTACTAACGCTAGTGGCGTTTGTTCTATTCAAAGCCCACAAGAAGTTTGCTATTTAGCTG
GTAAGTAACAACACGCAGTAATTATTTCATTAAAATTATTACTACGTTCAGGGGACGCT
CGAGTCAACCAAAACCCACAATTGACAATCCTTCAAATCATTCTTATGAGAGAACACAATCGAATTGCTGACGCTTTGGCCAAATTGAATCCACATTGGGACGACGAAACTATTTTCCAG
GAAGCTAGAAGAATTGCAATCGCCGAACACCAATTTATTTCATACTACGAATGGTTGCCGATTTTCATTGGAATTGAAAATTCGCTCAAGAACAAAATTATCTATTTGAGCAAACATTTT
ATCAACGATTATCGACAAGAAGTTGACCCGACGGTGCTTAACGAACACGCAACGGCCGCTTTCAGATATTTCCATTCGCTAATTGCAGGGCATTTGGA
GTAAGAGCACTTTTTTCTATAT
TTTTATGAATAATAAATTACGTAACATTTATACGTGAAAAAAACCAACTGAAAACAGAAAGAAATTTGAGATTTGAATGTGTTAAATAATAAACAGCATGACCTGAGGTGACCTGAGCTG
ACACTATTTGACAATCGACAAAAGTAATTTTTTACAATTTTCTGGTAAAATAAAAACATCCATCAAAATAAGCAAAATTTCGCCATTTTTACATCTAACATTATTCTACAACAATAAAAA
TATTCTCTAAAAAAATTTTATGTAATTCGCACAAATTGAGCAATTTTTTTATTAAGGGCCGATAATAATTCGAAGAAGCAATTAGATATAATTACAAAAAATTCAAACTTGATTTGTGAT
TTTCTGTATCGCCAAATAAACATTTTCAGTTTGGTAAACGAGCACCGCAGCAGCTACGGCAACTTGCGTCTCAGTGATTGGTTTAACCGTCCTGCTATTGTCGAACAGGGCGACAATTTC
GATGAATTGACTCGAGGTTTGGCCACTCAGCCGGAACTCGCTTCTGATCCTTACCATGACAGTGAG
GTAAAGTCGTAGCAATAACCGTGAAACCCAGATTACAATGCACATTTTTCAGAT
AACACAGTTTTTGTTCCGAGACGGACAACAATTCGGTTCGGATTTGAAAGCCATTGATATCCAACGTAATCGCGACCATGGACTTGCCTCCTATAACGAATATCGAGGTTTTTGTGGATT
GCCCAGAGCCCACAGTTTTGAAGATTTCCTCGATGTTATGACACAAGAC
GTGAGACAATAATTAATAATGTAATTGAAATGTAGTAATTTTTTTTTGATTGTCAGAATGTGAAAAAATTG
GCGACACTGTACGAAAGTCCCGACGATGTTGATTTAACAGTTGGTGGTTCGTTGGAAGCCCATGTTCCGGGTACTTTATCAGGACCAACATTCTTGTGTATTTTGACTGAACAGTTCTAT
AGAACTCGAGTTGGGGATAGGTTTTGGTTCGAGAATCAACACAACGGATTCACTTTAG
GTTAGTTGTTAAAGTAACCCAATTAAAAATAATTCAAACGTAATTACAGCACAATTAAACGC
AATTCGTAAAACGAGCATTTCGAGATTATTATGCGACAATGGCCATCACATCCAAGCCATGCAACCAAGAGGCTTTGAAAGAATATCTCACGA
GTACGTAGTTTTTTTTTTCTTCTTACA
TCATAATTAGTGTGAATTTGATTGATGAGAGAATTATTTTAGTAATCCGATTACACCGTGCGAAAATTTGCCAGCTGTTGATCTCACTTTGTGGAAGGAAGTTCCGTTTGGTGTCGAACG
TCCGTACGATTTCGGGTCGGACTTTTCCGATGAATTCTTTTGGAAGAAGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTACTTCCTGGCCCTTCTCCACTTGACCTTAGCTGAACCCAAAGGCTCGGGTTATAGCATTTTCCTCGAACACACGCCAAGTTGGGACAGGAGACCTTACGGTTACGGACCTGCG
GCACCAGTGGCCTTTGACCCTTTCAA
CAATAACAATTTCTTGCCACAACCACAACCACAACCCCCAACACCCGATCCGGCAACCTTAGGCTGTGGTACCCCACCAGCAGGGTGCCCCAAA
TCGAGGTACCGCTCCTACGATGGTTCCTGTAATAACTTAGGGAACCCAATTTTGGGTACTCCACAGACACGATACGCGAGGCTTCTACCGGCGAATTACGCCGATG
GGGTGAGCACCCCC
ACAGCTTCAGTAACGGGAAAACCGCTCCCAGGCTCTCGAATAGTCAGTCTTTTGATTTATCCCGATGTACAAATTGAAGATCCCAAATTTACAATTAATGCCATGCAATATGGGCAAATA
ATCACCCATGATATGAGCATGATTGCGGGAAGTACCCAAGCAC
AGCCCCATCAGACCAAGTGTTGTACGGCCGATGGTCAATTGCTCGAGTTTGCCAACATACCGGAACATTGTTTCCCT
ATAGTGTTGCCCAACGATGACCCCGCTCACTCCCAGACGAATGCAAAGTGCATGAATTTTGTAAGAACGATCACTGATCGTGATCGCAACTGTGTTGGAGGCTCACAACCGGCTGAACAA
TTAACTGCAGTTAACCATTACTTGGACTTATCGATAGTTTACGGTAACAGCGACCAAATCAACCAACAAGTCCGGCAATTCCAAGGCGGAAGACTTAGAGTTGAAGTACGAGATGGGAAA
GAATGGTTACCGAGGAGTACTAACGCTAGTGGCGTTTGTTCTATTCAAAGCCCACAAGAAGTTTGCTATTTAGCTG
GGGACGCTCGAGTCAACCAAAACCCACAATTGACAATCCTTCAA
ATCATTCTTATGAGAGAACACAATCGAATTGCTGACGCTTTGGCCAAATTGAATCCACATTGGGACGACGAAACTATTTTCCAGGAAGCTAGAAGAATTGCAATCGCCGAACACCAATTT
ATTTCATACTACGAATGGTTGCCGATTTTCATTGGAATTGAAAATTCGCTCAAGAACAAAATTATCTATTTGAGCAAACATTTTATCAACGATTATCGACAAGAAGTTGACCCGACGGTG
CTTAACGAACACGCAACGGCCGCTTTCAGATATTTCCATTCGCTAATTGCAGGGCATTTGGA
TTTGGTAAACGAGCACCGCAGCAGCTACGGCAACTTGCGTCTCAGTGATTGGTTTAAC
CGTCCTGCTATTGTCGAACAGGGCGACAATTTCGATGAATTGACTCGAGGTTTGGCCACTCAGCCGGAACTCGCTTCTGATCCTTACCATGACAGTGAG
ATAACACAGTTTTTGTTCCGA
GACGGACAACAATTCGGTTCGGATTTGAAAGCCATTGATATCCAACGTAATCGCGACCATGGACTTGCCTCCTATAACGAATATCGAGGTTTTTGTGGATTGCCCAGAGCCCACAGTTTT
GAAGATTTCCTCGATGTTATGACACAAGAC
AATGTGAAAAAATTGGCGACACTGTACGAAAGTCCCGACGATGTTGATTTAACAGTTGGTGGTTCGTTGGAAGCCCATGTTCCGGGTACT
TTATCAGGACCAACATTCTTGTGTATTTTGACTGAACAGTTCTATAGAACTCGAGTTGGGGATAGGTTTTGGTTCGAGAATCAACACAACGGATTCACTTTAG
CACAATTAAACGCAATT
CGTAAAACGAGCATTTCGAGATTATTATGCGACAATGGCCATCACATCCAAGCCATGCAACCAAGAGGCTTTGAAAGAATATCTCACGA
TAATCCGATTACACCGTGCGAAAATTTGCCA
GCTGTTGATCTCACTTTGTGGAAGGAAGTTCCGTTTGGTGTCGAACGTCCGTACGATTTCGGGTCGGACTTTTCCGATGAATTCTTTTGGAAGAAGAAATAA

Retrieve as FASTA