Entry information : AtPrxII01 (At1g65990 / PRXIIA / PeroxiredoxinIIA / Thioredoxinreductase2A / AtPrxIIA)
Entry ID 4352
Creation 2007-01-19 (Christophe Dunand)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: AtPrxII01 (At1g65990 / PRXIIA / PeroxiredoxinIIA / Thioredoxinreductase2A / AtPrxIIA)
Name (synonym) AtPrxII01 (At1g65990 / PRXIIA / PeroxiredoxinIIA / Thioredoxinreductase2A / AtPrxIIA)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII003]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrxII01
start..stop
S start..stop
AlyPrxIIA-2 796 0 1..549 1..535
AlyPrxIIA-1 592 0 158..541 2..383
AlyPrxIIA-4 526 0 156..549 2..396
AlyPrxIIA-3 526 0 156..550 2..392
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24573317..24573471 155 N° 2 24573138..24573217 80 N° 3 24571603..24573029 1427  
complement(join(24571603..24573029,24573138..24573217,24573317..24573471))


exon

Literature and cross-references AtPrxII01 (At1g65990 / PRXIIA / PeroxiredoxinIIA / Thioredoxinreductase2A / AtPrxIIA)
Literature Underwood,B.A., Xiao,Y., Moskal,W., Monaghan,E., Wang,W.,
Redman,J., Wu,H.C., Utterback,T. and Town,C.D. Direct Submission Submitted (09-MAY-2005)
Protein ref. UniProtKB:   Q7G959
DNA ref. Phytozome 11:   Chr1 (24573471..24571603)
Cluster/Prediction ref. Phytozome Gene 11:   19654867 UniGene:   At.52391
Omic ref. ATTED-II:   At1g65990 e-FP Browser:   At1g65990 Genevestigator:   At1g65990 TAIR:   At1g65990
Protein sequence: AtPrxII01 (At1g65990 / PRXIIA / PeroxiredoxinIIA / Thioredoxinreductase2A / AtPrxIIA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   553
PWM (Da):   %s   62476.51  
PI (pH):   %s   6.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPIDVGDFVPDGSISFFDDDDQLQTVSVHSLAAGKKVILFGVPGAFPPTCSMNHVNGFIEKAEELKSNGVDEIICLGDDPFMITACSENKHVKFVEDGSGEYIQLLGLELEVKDKGLGVRSRGFALLLDNLKVIVVNVGSGGDCSLFQLMKMTTTTMSNLPTDLLEEIISRVPRKYMRAVRLTCKRWNGMFKSQSFTKMHIGKEEAATRELRQTRMIVMMDYNVYLMGIAVNEIPSIETLGKLTCLDDSEQVKISQVFCCEGLLLCILKDDDTKIVVWNPYLGQTRWIQTRLICCVSGWKKYALGYGNNSENRSCRSPKILRVTDNFNIFSENIPLQYEIYDFDSDVWTTLDVSPHWFIMSERGLSLKGNTYWGAKERHAYGSIDHIICFDFTRERFGPLLPLPFSAWGAQFASLSSVREDKITALFQNCRAYKLELWITTKIDVNNATWSKFFTMDTPYLHEILSLKTFFIDEENKIVVVSNKERDTKGDLTHDSIDIINGEARCLWKLGLGKPADKNCWPLVCPYVPSVVQIKQHKGGKTKEQSDYKRH

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 3 exons) and 2 mRNA. Not expressed in the following article: Rouhier N and Jacquot JP, 2005, Free Radical Biology & Medicine 38:1413).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GACGTACGGT ACATCACATC GACGACTTAC GATGAAGGGT TTGTGTTTTC GTCCGCCCTT AAGAATTTGT TTACTTGTGC AGGAAGCATC CAGAATGTAA ACACCCAAAC TACACAAATC  AAAATCAAAA CCAAAACCAA AACATTCCCG CTGACAATCT TCGTCACCAT TATCAATCTC TTAAGCATAT TCAAGCATCT TCTTCTTCAC AACTATCTTA ATCCTCTGCA ACACATTCTT  TGTTGTCTCC TCAGTGACAA TCGCCTCAAC CCTTTGAATC AAACCCAAAA CGAATCTGAA CTCTGTAGTA CAATACCACC ATAATTGTTC CACTACAGCG ATTTCAACAT CCCTAAGAGC  TTTCCCAAGA AACCCTAATT CCATTCCTCT CTTCACCGAT TTCAACATCT CATTCGCAAG ATTCTCCACC AAATCAACAC GTGTCGTCTC CAACAAGTGA ACAGCCGCAC AGAAACCACC  CACAAACGCT AAACCCCACT GGCCCGAACT ATCTTCCTCG TTGTCACCTA AACGTTTCAA GATCGCTGGA AGAAGATTCT CCATGAGAGG AATCAAAAAC TCCTCTCCAT CCAAAGGCAT  CGACAAGCTC TTGAACACGG AAACCACTTT CACAAACTCT GATTCCGCTT TAGACGAGAT AAACTCACGC AGGTCATACC ACGTTTCTTC CTGAATGGTG AATATCTCGA AAGCGACACG  GTTCACGAGC ATTGAAAGAA TCTTTAAACT GGTGTCCGAG ACAACTTGTT CTTCAAGGCA TGATATGAGT ATAGGCGAGA GTATGTGAAC CACTGCTAAA TTCAAGGAGG CTTCTTCTAT  GATGAAGATA ACGTGGAGAC ATCTCATCGC ACCCTCTCTG ATCTCGTATG GGACGCGTGG CTCTTTCGAG GAGTAGACAC GCATGAGCTT GAGGGAGAAG CATCCCGGGT AATTGGCGAC  GCAGAAACAA AAGAACTTGA TGTCTTTATC TTCTGGATTC TCCGGTGGCT TTGTGAGGGC GGCGATGAAT TCCACCGTCG GTTCAATGTG AGGATTTGCA AGAAGCTTGA AGGCGGATTT  GGTGAAGTCT TGGGAGGTTG GTTGCTTCGG CGACTTCTGA TTATCCATGG GAAGGTAACA GAAAGTTCCG GGAGATCAAT AGAGTCTATA AAACGGTTGA AGAAAGAAAA GTATATAACT  GCTTTATATA TAGATAGATA ATGATTCTTA TATAGATAGA TAATGATTCT TCTGATTATC CAAACGCACG ATTTGTTAAA CTCTTTTTTT AATTCTTATA TAGATAGATA ATGATTCGTA  AGTTTTAATT TTTCTGTTAG AATTTTTTTT AGAGTTTAAT CTTCTACTAA TTAGTTGCCA AAAAAAAAAA AAAAGGTATT AAAATATTCT TAGTTTTAAA AAAACATAAA TCATAAATCA  TAAATCCTAG ATACATTTAA ATGACAACTA AAATTAAAAG AAACTTTCAA TTACAAATAT ATACTACCAT TAATTGAAAA TTTCTTTTCT TTAAATTTAT AAAAAAAGAA GCTTATCTGT  TCTTTGTTTA ATTAGTTGTC ATCTGTTGCA AGCCAACAAT AAGATGAAGT GTATTATCAA ATTTGATGAA TATATAAAAT ATATTTCAAA AACAGCATAT TTCTTTTTTA CAATTTATTA  AATATATTTC AAAAACAGCA TATTTAAATT CTCCACCCCT CCCAAAAATA ATTAAATTAC CATCAAATAT TTTAGAAAAT TTCATTAAAA TTACTACAAA ATTAATAAGG TTTTCTAAAG  AAGACTAAAA TCAAATTGAT TTTATTTCTT GAAAGATTTT ATCTTTTATA TATATATATA TATATATATA TATATATATA CAGAGATTTT ATATTTTTAC ATAATAATAT ATTCATAGAA 
AATACTCTCA AGCCCTAATT GGCTAATTTC ATTTTCCCTC AAAGTCCAAA ACTCTTCAAA TCTCTTTGCT TCTCAGCCTC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATGATCTAC ATGGTAAACG AATCAATCAA GAGGAGGTGG CAAAAGGAGA AAGCGAGAGT TGGTTAGTTT CAATTGACAA AGTCTAGTTT ATATGTCCTT TGTTTTCTTT TAGCAACATT  AATTTGTTTC TTCTCATCTC TTATTCAATA TGAACAAGAT TTTAGGATTT TTTTTGTTTT TTTTTAATTG TTACGAAATG GAGGGTGATC AAAGATTTAA GTACAAATTA TATACAACCT  GTAGCATTCT CTTCATCATC TTCATCCTTC TGGTCAATTT CACAGTTGCA TTTACATATT TTCCAACTAT CATCTGAAGA CCATATGGTG GTGGAGATTG CTCGTCTGTG GTGGATCAAC  TGGATTGCTA ATGTGCGCTT TTTGCTTGTA CTACGGGTAT GCGTGGAACG ACTAATCGGG GTAAATGCAA ATCTTGTTCT TCTTTGGATA CATGGTTTGC ATTTCCTATG GTTTCTTACT  CATGCTTGGA ACCATTTGAT TTGGTTCTTC TCTTCTCCAT AAAATGTGAA TAAGCAGTGA TTATTATTTT TTAATTACCC TCCCACTACT CAATTTCTCA ACAGATTTGA TATGACTGAT  TTTTTTTTTT TCATTTATGT ATGATTATTT TAAAATGTGT TTGTAAAGAA ATGTTATGCT TATATATTAT TATTACTATA GAAAGTTAGA TGTTGCTTAA TTTTGTGGTT TTTTGTCATG  GTACCAAAAC ATTCTTGGTC CTCTAGCCTT GTTGTCTACT TTTTTGAACA AAGCATCAGA GAGTTTTCAC GAAGAGAATT ATCTTGAAAA AAAGAAAAAA GAGAGAATTA TCTTTGATTA  TTGTTTGGGA CTATATGTTG TAGTCAAAGT CTCATTTTGG TTAAGGCGAC AGTTAGAGAA ACCGATGGTG AAGCTACGGT TCAAAGAAAC CGTAGTATAC TATTTTTCCT TATTCTTGAG 
TTCACTAAAC CTGAGGTATC AATTCCCAAA ATTGACCATT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAATTGATGTCGGAGATTTTGTACCTGACGGAAGTATCTCTTTCTTCGATGACGATGATCAACTTCAGACTGTCTCCGTTCACTCTCTCGCCGCCGGTAAGAAAGTCATACTC
TTTGGTGTCCCCGGTGCTTTCCCTCCTACATGCAG
GTACAAAGTTTCAAAACGTTTTCTGATTTATCCTTAAAATTATTTTTATAAGATGTGGGTTTTGGATTTGAGAATTGTGTTTTCT
TGTTATGAGGTTAGCATGAACCATGTGAATGGATTCATTGAGAAAGCAGAGGAGCTCAAATCAAATGGTGTTGATGAGATCATTTGCTTAAGTGGTAACTATGAATTGATATGTTTTTGA
TCTCTATGATGAGTTTGTGTATACTTCTGAAATCTGATCAAAACGTTTAATTGTATTGACGCAATGGTTTGATTGGTTGCAGGGGATGACCCATTTATGATTACGGCATGCTCTGAGAAC
AAGCATGTTAAGTTTGTAGAAGATGGGTCAGGAGAATACATACAACTTTTGGGACTTGAGCTTGAAGTCAAAGACAAGGGTCTTGGTGTTAGGTCAAGGGGATTTGCTCTGTTACTTGAT
AACCTCAAGGTGATTGTAGTCAATGTTGGATCTGGTGGTGATTGTTCCTTGTTTCAACTTATGAAGATGACGACGACGACGATGTCAAATCTTCCAACGGATTTGTTAGAGGAAATTATC
TCTAGAGTTCCTCGGAAATATATGAGAGCAGTGCGATTAACTTGCAAAAGGTGGAACGGTATGTTCAAAAGCCAGAGCTTTACGAAGATGCACATTGGCAAAGAAGAAGCAGCAACAAGG
GAACTAAGGCAGACTCGGATGATAGTGATGATGGATTACAATGTTTATTTAATGGGCATTGCAGTCAATGAAATTCCATCCATAGAGACTCTAGGTAAACTTACTTGCCTAGACGATTCA
GAACAGGTCAAGATATCTCAAGTCTTTTGTTGTGAGGGTTTATTGTTATGCATCTTGAAAGATGATGATACTAAGATTGTGGTTTGGAATCCGTATTTGGGGCAAACAAGGTGGATCCAA
ACAAGATTGATTTGCTGCGTTAGTGGATGGAAGAAGTACGCTCTCGGATACGGAAATAATAGTGAAAACAGATCTTGTCGTAGCCCCAAAATCTTGAGGGTTACAGATAATTTCAACATT
TTCAGCGAAAACATACCTCTCCAGTATGAAATCTATGATTTTGATTCTGATGTATGGACTACTCTTGATGTGTCTCCACACTGGTTTATAATGTCTGAACGTGGCCTTTCTCTCAAGGGA
AACACTTACTGGGGCGCTAAAGAACGGCACGCATACGGATCCATTGATCATATAATCTGTTTTGATTTTACAAGAGAGAGATTTGGACCGCTTCTACCTCTGCCATTTAGTGCTTGGGGT
GCACAGTTTGCGTCACTATCTTCGGTTAGAGAAGATAAAATCACTGCTTTATTTCAGAATTGCCGAGCATATAAGCTTGAGCTATGGATTACGACTAAGATTGATGTCAACAATGCGACG
TGGAGCAAATTCTTCACAATGGATACACCATACCTTCACGAAATTCTTTCATTAAAGACTTTCTTCATTGACGAGGAAAATAAAATTGTTGTGGTTTCTAATAAAGAAAGAGACACTAAA
GGCGACCTAACGCACGACAGTATTGACATCATTAATGGAGAGGCTAGATGCTTGTGGAAATTGGGGCTTGGAAAACCGGCAGACAAAAACTGTTGGCCACTTGTGTGCCCTTATGTTCCA
AGTGTAGTGCAAATCAAGCAACATAAAGGAGGCAAAACGAAAGAACAGAGCGATTATAAAAGGCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAATTGATGTCGGAGATTTTGTACCTGACGGAAGTATCTCTTTCTTCGATGACGATGATCAACTTCAGACTGTCTCCGTTCACTCTCTCGCCGCCGGTAAGAAAGTCATACTC
TTTGGTGTCCCCGGTGCTTTCCCTCCTACATGCAG
CATGAACCATGTGAATGGATTCATTGAGAAAGCAGAGGAGCTCAAATCAAATGGTGTTGATGAGATCATTTGCTTAAGTGGGGAT
GACCCATTTATGATTACGGCATGCTCTGAGAACAAGCATGTTAAGTTTGTAGAAGATGGGTCAGGAGAATACATACAACTTTTGGGACTTGAGCTTGAAGTCAAAGACAAGGGTCTTGGT
GTTAGGTCAAGGGGATTTGCTCTGTTACTTGATAACCTCAAGGTGATTGTAGTCAATGTTGGATCTGGTGGTGATTGTTCCTTGTTTCAACTTATGAAGATGACGACGACGACGATGTCA
AATCTTCCAACGGATTTGTTAGAGGAAATTATCTCTAGAGTTCCTCGGAAATATATGAGAGCAGTGCGATTAACTTGCAAAAGGTGGAACGGTATGTTCAAAAGCCAGAGCTTTACGAAG
ATGCACATTGGCAAAGAAGAAGCAGCAACAAGGGAACTAAGGCAGACTCGGATGATAGTGATGATGGATTACAATGTTTATTTAATGGGCATTGCAGTCAATGAAATTCCATCCATAGAG
ACTCTAGGTAAACTTACTTGCCTAGACGATTCAGAACAGGTCAAGATATCTCAAGTCTTTTGTTGTGAGGGTTTATTGTTATGCATCTTGAAAGATGATGATACTAAGATTGTGGTTTGG
AATCCGTATTTGGGGCAAACAAGGTGGATCCAAACAAGATTGATTTGCTGCGTTAGTGGATGGAAGAAGTACGCTCTCGGATACGGAAATAATAGTGAAAACAGATCTTGTCGTAGCCCC
AAAATCTTGAGGGTTACAGATAATTTCAACATTTTCAGCGAAAACATACCTCTCCAGTATGAAATCTATGATTTTGATTCTGATGTATGGACTACTCTTGATGTGTCTCCACACTGGTTT
ATAATGTCTGAACGTGGCCTTTCTCTCAAGGGAAACACTTACTGGGGCGCTAAAGAACGGCACGCATACGGATCCATTGATCATATAATCTGTTTTGATTTTACAAGAGAGAGATTTGGA
CCGCTTCTACCTCTGCCATTTAGTGCTTGGGGTGCACAGTTTGCGTCACTATCTTCGGTTAGAGAAGATAAAATCACTGCTTTATTTCAGAATTGCCGAGCATATAAGCTTGAGCTATGG
ATTACGACTAAGATTGATGTCAACAATGCGACGTGGAGCAAATTCTTCACAATGGATACACCATACCTTCACGAAATTCTTTCATTAAAGACTTTCTTCATTGACGAGGAAAATAAAATT
GTTGTGGTTTCTAATAAAGAAAGAGACACTAAAGGCGACCTAACGCACGACAGTATTGACATCATTAATGGAGAGGCTAGATGCTTGTGGAAATTGGGGCTTGGAAAACCGGCAGACAAA
AACTGTTGGCCACTTGTGTGCCCTTATGTTCCAAGTGTAGTGCAAATCAAGCAACATAAAGGAGGCAAAACGAAAGAACAGAGCGATTATAAAAGGCATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAA TTGATGTCGG AGATTTTGTA CCTGACGGAA GTATCTCTTT CTTCGATGAC GATGATCAAC TTCAGACTGT CTCCGTTCAC TCTCTCGCCG CCGGTAAGAA AGTCATACTC  TTTGGTGTCC CCGGTGCTTT CCCTCCTACA TGCAGCATGA ACCATGTGAA TGGATTCATT GAGAAAGCAG AGGAGCTCAA ATCAAATGGT GTTGATGAGA TCATTTGCTT AAGTGGGGAT  GACCCATTTA TGATTACGGC ATGCTCTGAG AACAAGCATG TTAAGTTTGT AGAAGATGGG TCAGGAGAAT ACATACAACT TTTGGGACTT GAGCTTGAAG TCAAAGACAA GGGTCTTGGT  GTTAGGTCAA GGGGATTTGC TCTGTTACTT GATAACCTCA AGGTGATTGT AGTCAATGTT GGATCTGGTG GTGATTGTTC CTTGTTTCAA CTTATGAAGA TGACGACGAC GACGATGTCA  AATCTTCCAA CGGATTTGTT AGAGGAAATT ATCTCTAGAG TTCCTCGGAA ATATATGAGA GCAGTGCGAT TAACTTGCAA AAGGTGGAAC GGTATGTTCA AAAGCCAGAG CTTTACGAAG  ATGCACATTG GCAAAGAAGA AGCAGCAACA AGGGAACTAA GGCAGACTCG GATGATAGTG ATGATGGATT ACAATGTTTA TTTAATGGGC ATTGCAGTCA ATGAAATTCC ATCCATAGAG  ACTCTAGGTA AACTTACTTG CCTAGACGAT TCAGAACAGG TCAAGATATC TCAAGTCTTT TGTTGTGAGG GTTTATTGTT ATGCATCTTG AAAGATGATG ATACTAAGAT TGTGGTTTGG  AATCCGTATT TGGGGCAAAC AAGGTGGATC CAAACAAGAT TGATTTGCTG CGTTAGTGGA TGGAAGAAGT ACGCTCTCGG ATACGGAAAT AATAGTGAAA ACAGATCTTG TCGTAGCCCC  AAAATCTTGA GGGTTACAGA TAATTTCAAC ATTTTCAGCG AAAACATACC TCTCCAGTAT GAAATCTATG ATTTTGATTC TGATGTATGG ACTACTCTTG ATGTGTCTCC ACACTGGTTT  ATAATGTCTG AACGTGGCCT TTCTCTCAAG GGAAACACTT ACTGGGGCGC TAAAGAACGG CACGCATACG GATCCATTGA TCATATAATC TGTTTTGATT TTACAAGAGA GAGATTTGGA  CCGCTTCTAC CTCTGCCATT TAGTGCTTGG GGTGCACAGT TTGCGTCACT ATCTTCGGTT AGAGAAGATA AAATCACTGC TTTATTTCAG AATTGCCGAG CATATAAGCT TGAGCTATGG  ATTACGACTA AGATTGATGT CAACAATGCG ACGTGGAGCA AATTCTTCAC AATGGATACA CCATACCTTC ACGAAATTCT TTCATTAAAG ACTTTCTTCA TTGACGAGGA AAATAAAATT  GTTGTGGTTT CTAATAAAGA AAGAGACACT AAAGGCGACC TAACGCACGA CAGTATTGAC ATCATTAATG GAGAGGCTAG ATGCTTGTGG AAATTGGGGC TTGGAAAACC GGCAGACAAA 
AACTGTTGGC CACTTGTGTG CCCTTATGTT CCAAGTGTAG TGCAAATCAA GCAACATAAA GGAGGCAAAA CGAAAGAACA GAGCGATTAT AAAAGGCATT GA 

Retrieve as FASTA