Entry information : AtPrxII06 (At3g06050 / PRXIIF / PeroxiredoxinIIF / Thioredoxinreductase2F / AtPrxIIF)
Entry ID 4354
Creation 2007-01-31 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information: AtPrxII06 (At3g06050 / PRXIIF / PeroxiredoxinIIF / Thioredoxinreductase2F / AtPrxIIF)
Name (synonym) AtPrxII06 (At3g06050 / PRXIIF / PeroxiredoxinIIF / Thioredoxinreductase2F / AtPrxIIF)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Buds
Mixed tissues
Roots
Seeds
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrxII06
start..stop
S start..stop
AlyPrxII06 405 4e-147 1..201 1..201
ThasPrxII03 362 8e-130 1..201 1..201
CclPrxII05 318 3e-112 1..201 24..224
LuPrxII119 317 2e-111 1..201 55..255
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1827594..1827809 216 N° 2 1827478..1827507 30 N° 3 1827227..1827385 159 N° 4 1826507..1826601 95
N° 5 1826311..1826416 106  
complement(join(1826311..1826416,1826507..1826601,1827227..1827385,1827478..1827 507,1827594..1827809))


exon

Literature and cross-references AtPrxII06 (At3g06050 / PRXIIF / PeroxiredoxinIIF / Thioredoxinreductase2F / AtPrxIIF)
Literature Salanoubat M. et al.

"Sequence and analysis of chromosome 3 of the plant Arabidopsis thaliana."

Nature 408:820-822(2000).
Protein ref. UniProtKB:   Q9M7T0
DNA ref. Phytozome 11:   Chr3 (1827809..1826311)
Cluster/Prediction ref. Phytozome Gene 11:   19661111 UniGene:   At.20442
Omic ref. TAIR:   At3g06050
Protein sequence: AtPrxII06 (At3g06050 / PRXIIF / PeroxiredoxinIIF / Thioredoxinreductase2F / AtPrxIIF)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   201
PWM (Da):   %s   21319.05  
PI (pH):   %s   9.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMSILKLRNLSALRSAANSARIGVSSRGFSKLAEGTDITSAAPGVSLQKARSWDEGVSSKFSTTPLSDIFKGKKVVIFGLPGAYTGVCSQQHVPSYKSHIDKFKAKGIDSVICVSVNDPFAINGWAEKLGAKDAIEFYGDFDGKFHKSLGLDKDLSAALLGPRSERWSAYVEDGKVKAVNVEEAPSDFKVTGAEVILGQI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 4 introns), 4 cDNA and 70 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTGTTAACCA AGGTGTGTTT ACGGCGAAGG AGCTGGTGAA ACATAGTCCT GAAGATGTCA AATTCACGAT TGACGTAAAT CTTGTTGGGA GCTTCAATGT GATTAAAGCC GCTTTGCCTG  CCATGAAAGC AAGGAAAGAT CGTGGACCTG CTTCCATCAG TCTCGTCTCC TCTCAAGCTG GTCAGGTTCG TCTCTCAAAT TTCCCATCTT TATGGATTTA AGTTTTATCT GGAGATTGTA  GTTACCTGAA GTAAGACATT GACAATTTAT CACTTGAAGT AACTTTTGTG TAACTGCAAT AATGTGACCT CATGTAATGC AGTTTTAAAG ATAGAATGAT GAAGGATGTT TTTTTTAATA  AAATTTTCAG GTTGGTGTCT ATGGTTATGC TGCATATTCA GCAAGCAAGT TTGGTCTTCA GGGTTTAGCG CAAGCATTGC AACAGGAAGT TATATCTGAT GATATTCATG TCACTCTTAT  TTTTCCTCCT GACACTAATA CACCCGGCTT TGAAGAAGGT AAAAAAGCTT CAGTATTTTT CAGATTCATC ATGGATGTAT AGAGCAGATA ATCTAAGTTT AACATGTGAG GGTAGCTAGG  ATTAGGTACT GCTACTAAAT ACTAAGGCAA TTAAATGTAT AAAAGAGTTG GAGACAGATT ACTAAATAAG GCTGTACTAT ATGGTTGGGA CATATGTAGA CATAAACTAT TATTCATCTA  GTTTGTTATT ATGAGATCAA ATATGTGCCC TTATCTGGTC TGAATAATTG TGTACTCTAT CAAACACGTA GCATTTCATG TTCACATGTT CTATGAGAGT GCCAGTTAGG AGAAACTGAT  AGACTGGTGA GTTAAGTACT GAGTACTGTG ATAGTGTTTA GCTTGAAGTC TCTGCGTACT GTGGTTCACA TGATACTGTT TAGAAGAGAA TAATGGGATG TAGTTATCTT CCAATAGCAT  CTGAAAATTT CATAAAAGAC TTCTTTTTGC CTATCTGAGA ATGAAGTAAG CACTTTTTTT TTTTTGATAA CTAATGAAGT AAACACATTA TGGACTGATG TTCTGAGTTC CTTGGTTCAT  ATTATGAGTT TGATTGATTT TCCTTGGGTG CTCTCTCAGA ACAGAAGAGC AGACCTGAAG TCACTGCCAT AATAGCTGCA TCCTCTGGTT CAATGGAAAC AGAAGAAGTA GCAAAAAAGG  CTATGGATGG CATAAAAGCA GGAAACTTCA CCGTCTCATG CAACTTTGAG GGATTCTTAC TGTCTCTCGC GACAACCGGC ATGTCCCCTC AAAGATCATT TTGGCTTGCT TTTCTTGAAG  TTATAACCGC AGGGCCTATA AGATTAATCG CTCTCTTCTT TCAATGGGAT TGGTATAAAG CCATTGAAAA ATGGAGCAAA ACCAAAACCA AATGGTAAGT TCCTAATGCC ATCAAGTTGT  CATCATATAG AATTTGCTCT TGCTTGACTG CGACATCACT ATTCTAAAAT TGCTTCTCTT TTGTAATTTC AGACAGCCCG ACAATGTATC TTGAAGTGCT TTTGGCAGAA GCTTAAACAT  TGATGGGTAT TCTCAAACCT TCTTCTCAGT CCGGTACCAC GCCAGCTAGT CGACTATACC AATTCAGAAT ATCGACATTG CTGATAGTTT TGTAGAAACT CGTCAAGATT CATGTTTCCG  GTCTTTGAAC AAGCTCTGTT TTTTCTTTTT TTTTATAGAG AAATCAAAGA ACTCATTTGA ATGTATTTTT TACTTGGTCA AGAAGTGAAT GTTTTTCACA AGATGAAATG TAAATGATGT  ATTTGAAAGA AGTAAAAACT TCAAAACCAA AATTTGAGTG TGTGCTGTTC TTGAGGCTTT TAAACAACGT GCAGTCTGAT TTGTTTGTTA CAAAACGGCA ACGATTAAGT CTCTTTAGAA 
AGGTCTTTGA GAAGTGCCAT AAACGACACT ATACAGTAAT CGAAGGAACC AAGAAACGGT CTCAATCTTA TTTTCAGCG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAAGTATTTC CAGAGTTGCT GTTTCTTCTG AGTTGCAACT GATAATAAGT TTGATCCGAA CATGTCTCAA GGATCAGACC AAGTAACAGC TTCACTTCTT TTGTTTTGTT TCCACAGTTT  CAGTTTAAAT AAAACTTATG TGTCTTGCCG TTTCTCACCA AATGTAAATC TGGTTCATAA TATGAATAAG AAACCAATGT GGTTGAGGGA TATGATTTTT CGTGTCCCCA TTGTCAACAT  GAAGGTTAAG ACTCCTCTGC TTAATCCTAA GTCTCCCACT CGTGTTCTTG AGCAATTTAG CTTCTTTCCT CGCTACCTGG TGTTTCTCCT TCCATTGTTG AGTCTCTAAC CTTGTGGCCT  CGAGATCTGT TTCTGCAATC ACAAGCTGCT CTTTCATTTG ACTAAAATCC GGAGCCAGCT ATTTCAAACC CAATGCCAAA TAAAGCCATT GCTTGTGGAG TATGAAGGTA TATAGATGAA  CTAGGTGCTG CTCTTGAGGG AGGACATGAA AGCTGAGTGG GTTGTTGTGA AAGGCCTTAC AAGGACGTAG TATGTCAAAT TTGTTGATAA GATCCTTATT GGGCTTGGCC CATAGACAAA  AGTAATTTTG AGCCGAAAAG AGGAATCTTT CCACTCTAAA CCCTATGCGT GACTCATCTC CGTCTCTCAC AGTAATAATC AAGTCAGAGC CGGCGAAGCT TGCCGTTTCC GCCGTTGGAG  GTAAGCCTTA TCTCTCTTTC TCATCTCCTT CTCCGATTTC CAACTCTCAG ATAATAGATT GGCGGTTCAT GGATCCCATT GTTTGATTTC GGAACTGTGT TAGCAGCTAA TAACCTAGAC  TATCAAATCT GATACATTGG AATTTATATT TGGGCTATTG ACGCTGAAAC CGATCTTATG AATCATCCTT TCTTACTCAC CATTTTGTTT CACTGATCTT GATATGTTCA TTTGATCTGC 
AAAGAAGAAA CCTTTGAACC TAAACCTATA CAATAGAAAC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGTCAATTCTAAAGCTAAGAAATTTATCGGCACTAAGATCGGCGGCAAATAGTGCCCGGATCGGAGTTTCATCGAGGGGTTTCTCAAAGCTCGCGGAAGGCACTGACATAACC
TCGGCGGCGCCTGGCGTTTCTCTCCAGAAAGCTCGCAGCTGGGACGAAGGTGTTTCCTCCAAATTCTCCACCACGCCATTGTCAGATATCTTCAAG
GTTCGAATCTCTCTTTTCTGACAA
TTTCAATTCAGAGGGGGATTTCAATTTCTGACAAAACGTTTGTGGATATTGATTGGTTGCAGGGGAAGAAAGTCGTCATCTTTGGTCTTCCTGTAAGAAATCTCTATCTTTTCATGTTCC
TTTATGTCTTGATCAGGTTTCTGAGTTCTGATGTTGTGCCGGAATATTCGTTTTCTGTGTTCAGGGGGCTTACACGGGAGTTTGTTCACAGCAGCATGTGCCTAGCTACAAGAGCCACAT
TGATAAGTTTAAAGCCAAAGGCATTGATTCTGTCATCTGTGTCTCTGTTAATGATCCCTTTGCTATCAATGGTTGGGCAGAGAAGCTTGGTGCCAAAGATGCA
GTAAGTTCATCGATTTT
TTTTTTGTTCCTATCTTTGTTCTTTGACACCAACCTAATCCGATGTTTAGTGTATGCTGATTTGGTTCTTTGCTTCAGAAAACTTGATTTGCAACATAACATATATTATTCGGTTCCTGG
TTTCGTTGTCTAAGAGTTTTCAGTGGTGAAGATGGTTCATTTAGGAATCTTTTAACTCCTCAAGTATGTAACTCTTGTTGACGTCCTGATAGTAATCAACCTCTTATAGTTAGAACTATA
TTACTCTATTATTCACGTTGTCTGTGGTCTCAAGATTTTATATTACACCAATAGACGATAAACAGATCTGATTCTATGATTAAATGGACTTCCCTTATTAGAAAGTTCATAATTCTTGAT
ATGGACTAGCATTACAATAGATTTCTATGTTTATGTTCGGATAAGTTTACGTGCTAGAAGAAATGACTTAAATGTGATGCTCTTGAACGTTGTCTATGATTACCTTCACATTAATAGACG
ATAAAAGAATTTGATTCTATGATTAAATGGACTTCCCTCATTAGAAAGTTCATAATTCTTTATATCGACTAGTACTACATGCTAGAACAAATGACTTAATGTGATGCTCTTGAACGTTGT
CATACCAGATTGAGTTTTATGGAGATTTTGATGGGAAATTTCACAAAAGCTTGGGGCTAGACAAGGATCTCTCTGCTGCATTGCTCGGGCCACGGTCTGAGAGGTAATATACTGGAAAGT
CCATTTGTAGAAATGTTTGTATCGTAAACCATTGATCTAACAGATTCGTTGGATTTATGATGTCCATGTTCAGATGGTCGGCTTATGTAGAAGACGGGAAGGTTAAGGCGGTGAATGTGG
AAGAAGCACCGTCTGACTTCAAGGTTACAGGGGCAGAAGTCATCTTAGGACAGATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGTCAATTCTAAAGCTAAGAAATTTATCGGCACTAAGATCGGCGGCAAATAGTGCCCGGATCGGAGTTTCATCGAGGGGTTTCTCAAAGCTCGCGGAAGGCACTGACATAACC
TCGGCGGCGCCTGGCGTTTCTCTCCAGAAAGCTCGCAGCTGGGACGAAGGTGTTTCCTCCAAATTCTCCACCACGCCATTGTCAGATATCTTCAAG
GGGAAGAAAGTCGTCATCTTTGGT
CTTCCT
GGGGCTTACACGGGAGTTTGTTCACAGCAGCATGTGCCTAGCTACAAGAGCCACATTGATAAGTTTAAAGCCAAAGGCATTGATTCTGTCATCTGTGTCTCTGTTAATGATCCC
TTTGCTATCAATGGTTGGGCAGAGAAGCTTGGTGCCAAAGATGCA
ATTGAGTTTTATGGAGATTTTGATGGGAAATTTCACAAAAGCTTGGGGCTAGACAAGGATCTCTCTGCTGCATTG
CTCGGGCCACGGTCTGAGAG
ATGGTCGGCTTATGTAGAAGACGGGAAGGTTAAGGCGGTGAATGTGGAAGAAGCACCGTCTGACTTCAAGGTTACAGGGGCAGAAGTCATCTTAGGACAG
ATCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACTATACAGT AATCGAAGGA ACCAAGAAAC GGTCTCAATC TTATTTTCAG CGATGGCGAT GTCAATTCTA AAGCTAAGAA ATTTATCGGC ACTAAGATCG GCGGCAAATA GTGCCCGGAT  CGGAGTTTCA TCGAGGGGTT TCTCAAAGCT CGCGGAAGGC ACTGACATAA CCTCGGCGGC GCCTGGCGTT TCTCTCCAGA AAGCTCGCAG CTGGGACGAA GGTGTTTCCT CCAAATTCTC  CACCACGCCA TTGTCAGATA TCTTCAAGGG GAAGAAAGTC GTCATCTTTG GTCTTCCTGG GGCTTACACG GGAGTTTGTT CACAGCAGCA TGTGCCTAGC TACAAGAGCC ACATTGATAA  GTTTAAAGCC AAAGGCATTG ATTCTGTCAT CTGTGTCTCT GTTAATGATC CCTTTGCTAT CAATGGTTGG GCAGAGAAGC TTGGTGCCAA AGATGCAATT GAGTTTTATG GAGATTTTGA  TGGGAAATTT CACAAAAGCT TGGGGCTAGA CAAGGATCTC TCTGCTGCAT TGCTCGGGCC ACGGTCTGAG AGATGGTCGG CTTATGTAGA AGACGGGAAG GTTAAGGCGG TGAATGTGGA  AGAAGCACCG TCTGACTTCA AGGTTACAGG GGCAGAAGTC ATCTTAGGAC AGATCTAAAA AGTATTTCCA GAGTTGCTGT TTCTTCTGAG TTGCAACTGA TAATAAGTTT GATCCGAACA  TGTCTCAAGG ATCAGACCAA GTAACAGCTT CACTTCTTTT GTTTTGTTTC CACAGTTTCA GTTTAAATAA AACTTATGTG TCTTGCCGTT TCTCACCAAA TGTAAATCTG GTTCATAATA 
TGAATAAGAA ACCAATGTGG TTGAGGGATA TGATTTTTCG TGTCCCCATT GTCAAC 

Retrieve as FASTA