Entry information : Cre2CysPrx01 ( PRX1)
Entry ID 4410
Creation 2007-02-01 (Nicolas Rouhier)
Last sequence changes 2016-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-02 (Achraf Jemmat)
Peroxidase information: Cre2CysPrx01 ( PRX1)
Name (synonym) Cre2CysPrx01 ( PRX1)
Class Typical 2-Cysteine peroxiredoxin    [Orthogroup: 2CysPrx001]
Taxonomy Eukaryota Viridiplantae Chlorophyta Chlorophyceae Chlamydomonadaceae Chlamydomonas
Organism Chlamydomonas reinhardtii    [TaxId: 3055 ]
Cellular localisation Chloroplastic
Tissue type N/D
Inducer Constitutively induced
Repressor N/D
Best BLASTp hits
Perox score E-value Cre2CysPrx01
start..stop
S start..stop
Cin2CysPrx01 477 3e-174 1..235 1..235
Mpu2CysPrx01 355 7e-126 15..235 27..250
Mvi2CysPrx 349 3e-124 30..235 1..210
Cpsl2CysPrx01 348 4e-123 6..235 26..267
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..378 378 N° 2 484..495 12 N° 3 913..1230 318  
join(1..378,484..495,913..1230)


exon

Literature and cross-references Cre2CysPrx01 ( PRX1)
Literature Goyer A., Haslekas C., Miginiac-Maslow M., Klein U., Le Marechal P., Jacquot J.P., Decottignies P. Cloning of a genomic sequence encoding for a thioredoxin peroxidase protein in Chlamydomonas reinhardtii. Eur. J. Biochem. 269:272-282 (2002).
Protein ref. UniProtKB:   Q9FE86
DNA ref. GenBank:   AJ304856
Cluster/Prediction ref. UniGene:   Cre.6477
Protein sequence: Cre2CysPrx01 ( PRX1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   235
PWM (Da):   %s   25846.4  
PI (pH):   %s   8.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAALQSASRSSAVAFSRQARVAPRVAASVARRSLVVRASHAEKPLVGSVAPDFKAQAVFDQEFQEITLSKYRGKYVVLFFYPLDFTFVCPTEITAFSDRYKEFKDINTEVLGVSVDSQFTHLAWIQTDRKEGGLGDLAYPLVADLKKEISKAYGVLTEDGISLRGLFIIDKEGVVQHATINNLAFGRSVDETKRVLQAIQYVQSNPDEVCPAGWKPGDKTMKPDPKGSKEYFSAV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo VI, 2 introns), 1 mRNA and 189 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCTCTGCAGTCTGCTTCCCGCTCTTCGGCGGTGGCCTTCTCGCGCCAGGCGCGCGTGGCCCCGCGCGTTGCCGCCAGCGTTGCTCGTCGCAGCCTGGTCGTGCGCGCTTCCCAC
GCCGAGAAGCCCCTGGTGGGCTCCGTGGCCCCTGACTTCAAGGCCCAGGCCGTGTTCGACCAGGAGTTCCAGGAGATTACCCTGAGCAAGTACCGTGGCAAGTACGTGGTGCTGTTCTTC
TACCCCCTGGACTTCACCTTCGTGTGCCCCACCGAGATCACTGCCTTCTCGGACCGCTACAAGGAGTTCAAGGACATCAACACCGAGGTTCTGGGTGTGTCTGTGGACAGCCAGTTCACC
CACCTGGCCTGGATTCAG
GTGCGCGAGAGCTGTTCGCAATTTCGTTCTCATTATGAGCCTGTGCTGACGAGTTTTGTGCCTGCCTTGCCCTTGCTCGCACGATTCACCTTCGCGATGATC
CAGACCGACCGCAAGGTGCGTTGGTTGTCCTTGGACCTGGGTTCACTTGCCTGTAGAAGCGCAATTGAGGTCATGAGAGCGGGCGCATGCAGCTGGGTCGCTGTCGCAATGCGTTGGCGT
TTTCCATGCTCCTCGAAACGTCCGTAGACGGGCTTCCAGCGGTACTGCATTTTCGCGCAACGGAGCTACTTTTCACAAAGTACAAGCTTTGGAAGGCAGTTTTGGACTGGGCCCACATTG
CCTGCTTGCAAACAGTCGCACCCGACTTGCTCACGCGCACAGCAGCCCTGCTTCTTCACCCTCGCCACAGCGTCCTGCACTCGCGCTTAGGCTCCCCTCCCTGCCGTCTCCAAGCTTCAT
ACGCGCGACGTCTCCAGCTCATCCTAATCACATGTCGCCTTCCCAACCCCATCGTTCCTTTGACCCCTGCAGGAGGGTGGCCTGGGCGACCTGGCCTACCCCCTGGTGGCTGACCTGAAG
AAGGAGATCTCCAAGGCCTACGGCGTCCTGACCGAGGACGGCATCTCCCTGCGCGGCCTGTTCATCATCGACAAGGAGGGCGTTGTGCAGCACGCCACCATCAACAACCTGGCTTTCGGC
CGCTCGGTCGACGAGACCAAGCGTGTGCTGCAGGCCATCCAGTACGTGCAGTCCAACCCCGATGAGGTCTGCCCCGCCGGCTGGAAGCCCGGTGACAAGACCATGAAGCCCGACCCCAAG
GGCTCCAAGGAGTACTTCTCTGCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCTCTGCAGTCTGCTTCCCGCTCTTCGGCGGTGGCCTTCTCGCGCCAGGCGCGCGTGGCCCCGCGCGTTGCCGCCAGCGTTGCTCGTCGCAGCCTGGTCGTGCGCGCTTCCCAC
GCCGAGAAGCCCCTGGTGGGCTCCGTGGCCCCTGACTTCAAGGCCCAGGCCGTGTTCGACCAGGAGTTCCAGGAGATTACCCTGAGCAAGTACCGTGGCAAGTACGTGGTGCTGTTCTTC
TACCCCCTGGACTTCACCTTCGTGTGCCCCACCGAGATCACTGCCTTCTCGGACCGCTACAAGGAGTTCAAGGACATCAACACCGAGGTTCTGGGTGTGTCTGTGGACAGCCAGTTCACC
CACCTGGCCTGGATTCAG
ACCGACCGCAAGGAGGGTGGCCTGGGCGACCTGGCCTACCCCCTGGTGGCTGACCTGAAGAAGGAGATCTCCAAGGCCTACGGCGTCCTGACCGAGGACGGC
ATCTCCCTGCGCGGCCTGTTCATCATCGACAAGGAGGGCGTTGTGCAGCACGCCACCATCAACAACCTGGCTTTCGGCCGCTCGGTCGACGAGACCAAGCGTGTGCTGCAGGCCATCCAG
TACGTGCAGTCCAACCCCGATGAGGTCTGCCCCGCCGGCTGGAAGCCCGGTGACAAGACCATGAAGCCCGACCCCAAGGGCTCCAAGGAGTACTTCTCTGCCGTGTAA

Retrieve as FASTA