Entry information : Hs1CysPrx01 (PrxVI)
Entry ID 4426
Creation 2007-01-25 (Nicolas Rouhier)
Last sequence changes 2010-12-03 (Myriam Duval (Scipio))
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2010-12-03 (Myriam Duval (Scipio))
Peroxidase information: Hs1CysPrx01 (PrxVI)
Name (synonym) Hs1CysPrx01 (PrxVI)
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Homo
Organism Homo sapiens (human)    [TaxId: 9606 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Hs1CysPrx01
start..stop
S start..stop
Ptro1CysPrx01-2 456 3e-166 1..224 1..224
Ptro1CysPrx01 456 3e-166 1..224 1..224
Pabe1CysPrx01 456 3e-166 1..224 1..224
Ggo1CysPrx01 456 3e-166 1..224 1..224
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 173446537..173446631 95 N° 2 173450465..173450621 157 N° 3 173454500..173454646 147 N° 4 173455394..173455540 147
N° 5 173456874..173457002 129  
join(173446537..173446631,173450465..173450621,173454500..173454646,173455394..1 73455540,173456874..173457002)


exon

Literature and cross-references Hs1CysPrx01 (PrxVI)
Literature Frank S., Munz B., Werner S. The human homologue of a bovine non-selenium glutathione peroxidase is a novel keratinocyte growth factor-regulated gene. Oncogene 14:915-921(1997).
Protein ref. UniProtKB:   P30041
DNA ref. GenBank:   NC_000001.1 (173446537..173457002)
mRNA ref. GenBank:   AAH35857
Cluster/Prediction ref. UniGene:   Hs.573688
Protein sequence: Hs1CysPrx01 (PrxVI)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   224
PWM (Da):   %s   24922.14  
PI (pH):   %s   6.29
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGGLLLGDVAPNFEANTTVGRIRFHDFLGDSWGILFSHPRDFTPVCTTELGRAAKLAPEFAKRNVKLIALSIDSVEDHLAWSDINAYNCEEPTEKLPFPIIDDRNRELAILLGMLDPAEKDEKGMPVTARVVFVFGPDKKLKLSILYPATTGRNFDEILRVVISLQLTAEKRVATPVDWKDGDSVMVLPTIPEEEAKKLFPKGVFTKELPSGKKYLRYTPQP*

Retrieve as FASTA  
Remarks Genomic DNA (Chromo 1, 4 introns), 21 mRNA and 1054 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTCGTAAGTGGCCACCGCGTAGCCCTGT
CCTGGCCTCGGTTGCGCCGGACTCGGAGGTGCCTTCCCTGTTTCTTCTCCCTGCCGTCCTCCCGGCCGCTCAGCCCCCTGCGCCGCCCTCGCCTTCCCCCGCACTGGTTCCGGCGCGCGC
CAGGCCGTGTGGCCTCTGCTCAGCGTCGGCTGCGCTGCTGGGAGCTGGCACCCGTTCGGCCTGCCCTGCGCGGGCCACTCGATCCCTCCTGGCCTCCCCGCCTCCGGCGTGGCTGGGCAA
GGCCACGCCAAGGTGGGGGGTGGGGAGGATAAAATTGTGTTCTGCGGGTTCTGGAAACTCACCGCCCGCGGGAGGGTTTGTTGTCCATTTAACTCGTCTTAGTAAACTGTGCAGGTAGCG
TGGTCAGGCCGAGGGCGCAGGGGCGGGGCGGCATTGACGATCACTTCCCCGGACTAGTGCCCAGGGTCGCACCGCCCTCCCACCCTCCGTTCTGGAATTTGCTCCCTGGGGAGGATGGGT
GTCTAAAGCCAAAGTCGGAGGACACAGCTGCTGGCTATAGGTTACAGGAAGGCCAACGTATCATCTGAGGGTGCAGTGGTATTTGCAGGCTTCTGGGCACAAAATGTGAAATTTAAAACC
ACTAGCTGCCAAGTAGGTGGCCGAAAGACTTTTTGTCCAGAGCCGCCTCCAATGGCCAAGATATGATTTGATAACAGCTTTAGGAAGAGCCAAGAACACTCTGCGTAGGTGTGCCTTCAG
AGATTCCAGAACTTGCAACACTTGGAGGGAAGGACTTTCTGACGCTGTTCCGCTGGAGTGGCCTATTCTTGCTAGTGATGGCCGTTCCAGGCTCCAGGACACGTGTACTCCCCAACTTTG
AGACTCTCTTGTTTTCCAGTGGCTTGCCCCTCACTGTCCCCTCCGCTTTCTACCTTGCTTCTAGCACATGAGCTTGCTGATGATAGCCAAATTGATGACCTGTGATCTGACTTGGCAGTT
TTACCATTATGGATAGGAGTAGTAAATCGGTGTTGCCCTTTTTTTTTTTTAACAGCTCCTGAATCAGCAAACTGGAAGTTGCTTAGTTTTCATCAGAAGCATTCCAGGCATGTCTAGTTA
TATTATGGTTCTGGAGTACTAGTGGTCCCACTACACTGTGGGGCTCCAAGGCTTGACAACAGTTCTTCCCCAGATTATATCCTTTTTATATACAGTATCCAGGGAGACAGGCTTATGAAA
TTAATCAGTGATTGGACAGGGCTGTGCAGAGAACCAGGGACAGATTCTTACACATCATATGCCTATCCAACCCTTTATAACCTCTTAAGTCCCTTTTCCAGCCACTGAATAGGGAAAAGT
TAAGCTTTGTGAAAGATAGGACTAGGCCAGAAAAAGGTTGAGAAATGGAATATTCAAACCTTGAATGCAGAAAAATACTTTAGAAATACAGCTTATGGCCATTCTTATACTTAGGATCTA
GGTAGTAATATTTCTCCAGCAATCCTTGGGATTTTTAGAGTTGTGTTCCTTCCCATTTCTACCTGCAGCCCTCATCCCCCATCCCCATGAAACATAAACTATTTCCAGAACTCTTAGCTT
GTATAGATTAAATATTAGCATAAAACGTATTTACTGTGCCAACAGTTATAAATGCTGTCACTTTTTAAGCTAACCATACTTTTTTGGGGTTTTGTTAATGTTTATTGGCCTCTAGATCCA
TCTAGATTTGATCAAAAGTGGTACTTTATCAGGGAGCCATAGTTAGGAACACGGTAGAAATATCTGCATTTATTAACTAATATACAAGTCTGCCTAGGATCAGGTATAGTATTCCCTACC
TTACCGGGAAGAGAAGTTTGAGCCTTTTATATGTTTATAACACATGGATTTTTGCCTGATTTTTCCAATTTTCTATTCTGTATATGATCCCAAATCAGACTGTCAATTTTTGATCCAGGT
ATTTTTGAGAAGAAAAAATTAAAATGTATTTCTCTACCTTACCCCTGATCATTGTAAACAACTAAAGAGGTTGGGTGCTACATTGGGTGAGTTTACCTTATCGCTGTTTCTTTAAGTGGT
AGAAGCAGCTTCTTCATAGTACATCTTCACTAAGCAAAATATGTGTTTTCCAGGGGTCTTCTGGGGCTTAGTAAGTGGGAACCATTCTCTTGAAGGAGGAAACCTTTTGTCTTTTGAAAA
TGGGTAAGAAAATGGGAGCATGTCACTGAATTACTCTTAAGTGCAGCAGTAGGAAGACTTGGAGGGGAAGGAAGGCCAAGGTAAGACATTCTTGGAGTTTATCCTATTTGTAGCCATGAG
GTAAACTGGAGTTTCACTTCTGAGGGAGGGAAGGACGTGAACTGGCTTAAAACCAGTTCCTTTTGCATGATTCAGCAAAACAGTCTTTATGGACTCACAGTGGAAAAAGAACTCCTAACT
TTTCTAATTTATCCTCCTTTTAACGATAGAGGAGGAAACGCCCTGTTCCATTTCTTCTCAACTTCTGGAGACCTTCTGTTAAGTCTCATCTAACCATTAAATAGATCGTTTTCCATAGAA
TCTAAGGCCTAGATTTTACTCATAGTGATATTATCTACTTCAAAAGATATACTCTATGTTCTTCCTTTTGCCCTTCATAGTAAAGTGAACATAGTGCACACCTCCACAATCTTAAAAAAA
AATACTAACTTTCCTCCCAGTCTTGCCATAGGGCCCTCCATCCTTTTTGTAAGAAGATCTTTTTCCTTCTTGAAACCTTGGGAGTTGAGTGGCAGCCGTAAGTAGGAAGGAGGTGCCCTT
GTCTTTGCTTGTTCTCTGTGCTCAGGGAAACTTCAGAAAGGTCAACTTGGCATCTAGGCTAGATTTAGTTATCTACTAGTTTAGGATCCTGCCTAAATCATCTGGTTTAGGATGGTTTAA
GTTGATGGGGATGTGGAGAACTGAGTGTTAAATTTTCCTTTTCAGTTGAAAGAGTAGTTTCTGTTGCCAAGAAGAAGGAAATGGTACTTCAGCTTTCTTCGTGACAGCTTGAAATGTGCT
CAAAATTATAAAATCTTAGACAATGATGACTTAGATATTAGTATTTACCTAAGAATTTGCTGTTGTAGAAATCTACATTGCAGGCTATCAAAATTCTACCTGCTTGGTCTGAAGAAAGAA
GAAAAAGAAACTGCAAATGAAGAGATAGGTAAAACTGTGAAGGTGCTATTGTTTTGTCAGAGTATAAATATTGGGTGTCATGTTTGGCAGGTAAGATCAGTAAAGTGGTTTTACAAAAGA
TTTTATATCCACTTGCTTCAGAGAAGCCAAGTGTCAACTTTAATTTTTACATATAAATAGAAGATAGAAACCTATTTATTTCAGATTACATAATTTGTTTATTATTGCAGTCAGGCATTT
GTTTGGATTCAGGGCATACTGGGACATCCATTATTGGAGCTGAATGTCAGGGTCTATGCTAGAAAAAAATGTAGAAAAGGATAAGAAGAAATAATTAAGTGTTTTCAGTGAACTACTTGG
CTTGAATAGCACAGATTGTATTAGCCAAAAAGGAGTCAGGGTGGCACCATAATTATTAAAGGAGGCAACACCTTAACATTAGTCTTTTTAAATATGTGTCATCTTGAATTTCATGTCTTT
GATTGAATTGGGCTATAAGCATAGGCTTCTCTGGAGGTAAGTAGATTGAAAAGCACTCCTCAACAGAAAAGCTTAAAAGTAAATATCATCATAAGCATTCATTTAAAAAAGAAAGCCTGT
TTTTGATCCAGAAGTTGTGACTTTTCATTCTCTGTGATGTTGGTGATAACTCTTAATTCAATTGTGACCTTGTTTTTCTTCCTTTCAGATGGGGCATTCTCTTCTCCCACCCTCGGGACT
TTACCCCAGTGTGCACCACAGAGCTTGGCAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTCAATAGACAGTGTTGAGGACCATCTTGCCTGGA
GCAAG
GTTAGTATCAATTGGCATGTGCTTTGAGCCTGAGATTATAGGTCAAGTTATAAATTATGGAGTACTTGGTTTTGAGGTTAAGGTACAAGTAAGCCTTAGGTTCAAAGTTCACTAA
TTATTTGAAAATTTCAGTTGAACCACACAGTGATCACATTGCTAAATCCATTGGTCAGTCAATTCTCAGCCCTCCTCTTGGCCTGCCAGCAGCATTCAACCCAGCTGATCACTGTACCTC
CTGAAACTTTTTCCTTTCTTGACTTCCAGGACACCACATTCTAGCTGTTCCTGCTCACTGATTCTTCATCTCCCAACTCCTAATTTATGCTGAAGTTACCCTGAACTTATTTCTTGGACC
TCATCTCTTTTCTGTCTGCACTCTTTCCCTTGGTGAGCTCATCCACTCACCTTTAAATACCATCTATGTGCTGTGATTCTCAAATTTTCATCTCTATGCCAGACTCTTCCAGGTTCATAT
AACCACTGCCTACCTAGCATCTCTCCTGGGATGTCCAGTCATCTCAAACCTAGCATGTCTAACTAGGCCTCATTCTTAGATCCAGAGTTTTACTCATCTAAGCTAATGGCAACTACATTT
TTATAGTTGTTCACACCCCAAATCCAGGAGCCATTCTGAATTCTTCATGTTTTTTCACATCATACATCTGATTTATCCTCAAACTTGTCAGCTCTACCTTCAAAATATGTCCTGTATCAT
AGATAGAAGACTCACTTCCCAGGGATCTGTGTGACTTACCCTCACCTCTTTTGGGTCTCAACTCACAGGACATTTCATCAAAGCCTTTCTTGTCCTCATTATCTAAAATTATAACTCCTT
TTCACGTTCACCATCCCCTTCTCCTCAGCACTCTGCATACTACCTATTTAGTTTGTTTGTTTCTTCCTAGTAGAGTATAAACTCAGCAGGAACAGAGACTCCTGTTTAGTGCACTGCTGG
AACAATGCTCACTACTCAGTATATCCTAGGCGATCAGTCAATATTTGTTGAATGAATTAACTGAAGGAAATACCTACTTCTAGCAAAAGAATTTACTTGAACAGTAAATTTGGTGGTCTG
AATTTACCTTGAAAACATTTTAAGAACTTGACTGCACTGTGCTGTTAAGTAATAATGATAACTACTTTTTGAGGGATGTATACTAGAAACTATGTCAAACGTGCAGTTGAATAAAAGATG
TATTGACTTGTGAGTTAGGGGTCTGTGGCTGCATCCTATAGCAGTTAATGCCAGTTAATCCTAAATATCTGAGACTAGAAGAATCATGTGTAGGAGAAAAAAGAAGGGCAGTTATCTGTC
TTGAAGTAGAATTTTTTTTCATTCCTTACACTTCTCAGTGAGTGGTAACTGTAGTTTTTGCTATCATTTTTCATTTTCGTTTTTGCAGTTGAACATACTTTTTTCACTCAGAGAGTTGGA
GGGACTTGCCCAAGACTGCCCAATGGCAATGAGATTTCAACCTCAAATCAATGTTCTTTTTAATGCAAGATGATAAAGAGTAGGATTTAGCCTAATTTAGGATAGAATAAAGCCAAATAA
TTTAGGATAGGTTCTTTGGTGTTCATGGGTGTAATCTAATGCCCATGATGCAAGTGGCAGAGTAGAGAATTAGTGCACAGCAATAATTAAAGTGACATATTGCCAAAGGAAGCGGTTATA
GCCCATTATATAATACCTTTTAAAGGACAGACGCATACTCAGGTTTATTTTACCTGCTGAGCTTCTGCCTTAGAAGTTTTCAGAATTGTGATTACATTGAATAGGAAAAAAGTCTGAACT
ATCAGAAGCAGTGCCGCAACTTTGACAAACAACTGATTATATAATAATCTGCCTCTAGCATGAGACTATATTAATTATTATTTAGCTCTGGTGACTTCATAAGCAGCCAGTGACAACAGA
AAGTTAAGATAATAAAATGAAGGAATGTTACAATTTGTTATCATCCGGGAGCCTGAGGCAGGAGAATGGCTTGAACCCGAGAGGTGGAGGCTGCAGTGAGCTGAGATCGCGCCACTGCAC
TCCAGCCTGGGCAACAGAGACTCCACCTCAAAAAAATAAATAAATAAAAAGAATTTGTTGTTATCCACTTCAGAGCTCATTAATGCCACATTTGTCACATCTCCGTTGAGAAATCCACAA
TGGTTTTGTATCTGCTATGCCATCAAGCCCCTGTTTTACTTTCAAGCCTACACACAATAGACGTTATTCCAATTTTAAATCCTCTTTTCCATTACTTGCTAAACTCTATCCAACTAAGTT
CCTCACTCTCCTATCAATAGTTTATGTACAGAGTTGCCCACATGTTTCATTAATATCGTTCCTGGCCGGGCACAGTGGCTCTCGCCTGTAATCCCAACACTCTGGGAGGCTGAGGCAGGT
GGATCACAAGGTTAGGAGTTCAAGGCCAGCCTGGCCAAGATGGCGAAACCCCGTTTCTACTAAAAATACAAAAAAAAATTAGCCGGTGTGGTGGCGGGTGCCTGTAATCCCAGCTATTCA
GGAGGCTGAGGCAGAGAATTGCTTGAACCTGGGAGGCGGAGGTTGCAGTGAGCCAAGGTTGCGGTGAGCCAAGTTCGCACCAGTGCACTCCAGCCTGGGCGACAGCAAGACTCTGTCTCA
AAAAAAAAAAAAAAAAAAAATTAGATATATATATTTATATATATATATATTTATATATATACACACACACACACATACATATATATACATATGCACACGTATATAATATATATACACATA
TATATATGTGTGTGTGCATATATATATATAGTTCCTGATTCCTAGAATGCCTTTCTTTTCTCTGTGAAAAATCTTACCCATCCTTCAAGGGCCTAGATAGAAGTCCTGTTCTTTTCTTGA
AGCCTTTTGTAACTTTTGGAGTCCTACAAATGGGAGTGTTCGTATACTTCAGTATTTACCATCCACCATTTAACATTAGTCTTGCATTTGCTGCTGCTTCATACTGGAATCATCTCTAAC
CAAATGAGAAGTTCCTTTGAAGGGAGGAGCCGTGTCTTACTCATCTGTATTCCACATGTATTTACCATAATGCTTAGCCCACCTTAAGTGCTATATCAATGCTTAATCAAATAACAAAAC
TAGATTTTTTTTTTCTCCAAAAGCTTCCAGGGATAGGAAAAGTAGAAATAAATGGATGAATAAAGTTTTACTAGGGAAGGAGGGAAGTGTATCATTTTTCTTTAGTTCAGACTTGAAATG
CTTTGTTTTCTCTTTGAATTTCACCCTAGTTTAGGTTTACTTCTGCCTCTTCACCCATTTATTTTTGACTTGTCCTTCAAGTATATATTCAACTCTCCATTCTTGTGTTTGCTTTGTTTT
GTGATTTGTTTTTTTTTTTTTTGGTCATTTCTTATTTGTCTTGTAACTTAGCATCTGAGTCAGGGTGCTTTATGAGGTAGGGACCAGATCTATAAGATTTTCTTTACATATGGCATTATT
TCTAGATGTGATGGATTTAACAAACCTATTGTTATCTGATGATTTTTACAGTATTTGGGTACCCAGAGGTACCTTGTATTTGGATCTAACTAAATTATTGCAATTTTAAAGGGGTTGCTG
CTATTTTCTCATAGCAGTAAAAGCATGCTGAATTTAAGAGAACTGGGCATGAAAACAGCTTTGGTCCATGATTACAACCTAAGTACTGTACTCTGCTGTTATTCCTGGCAATAATTGGAA
TGAAGAGTGTTCATCTACTCACTTTTTAAAATTAAAATTGCTTAAAGAAAATTACTGTGATTTGGTCCTCTTTCCTGTCTTGCAAGGTGATGGCTGTTAACTGATGAAATTCAGAGCATG
TGTTGGGTTTAGATTCCTCTTTCCCCTTTTACTTGTGTTTCAGGATATCAATGCTTACAATTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGATGATAGGAATCGGGAGCT
TGCCATCCTGTTGGGCATGCTGGATCCAGCAGAGAAGGATGAAAAGGGCATGCCTGTGACAGCTCGTGTG
GTAGGTCATACAAATTCATTTTGTAGTTAGCTTAACTGATCAGGCTGTAT
GTCCGTGTAAATGCTGGTACCAGCTAGAGGAGATAGGGGAATATCTACGATTATGAAATAACTGTGTATTGGCGACAATATCACTGATTATCTGTAATGCTGATGCAATTTTCAGCTAAA
TTTTCCAACTGCTTTATTCATAGTTCATGGAAATCTACAAAAAAAAAGTTGTTTATCCTAAAATGTCTTCCAGAATTGAGAAACCTTTTCATAGCTCTCCTGACTGCTCTCCTGACCGCC
CTGTCTTTAAAGTGATGGGCCATATCCTTCTTCATAAGGCAGCTCTGTTTTAAATTTTTATTTGTTCTGTCCTCCGCCCACTAGAAAACAAACCCAATCCCTCATCTGAATAAATGCACA
ACTATTCAAGGAACAATATCAACTCCCATTAGTATTATTTTTATGATAGTCATCCCCAATTGACACAGCCTTTCCCTCGATTAAATTTGCATATCAGTTTTTCTTACTGGGAAAGCCAGA
ACCAAATAGAATTCCCTTCTACGTTTAGAAAATAACAGGGAGAAGAAAATTATCTGTATTCCAGCCATCCACATTAGCAGTTGGTGTATCCTTCTAGATGCTTTGTTTTTGTCTTGTTTT
TATACCCTTGAACATTATTAATGACTGCAGAGCTTTCTAAGTGGCTTTAATAACACTCAAAGAACTCTTCCTATTTATGCCCCTCTGTGCTTTACAGGTGTTTGTTTTTGGTCCTGATAA
GAAGCTGAAGCTGTCTATCCTCTACCCAGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGGGTAGTCATCTCTCTCCAGCTGACAGCAGAAAAAAGGGTTGCCACCCCAGTTGATTG
GAAG
GTAAAGATGTTTTTAAAAAGCAGTTTCTCTACTTGCCTGAAGGGCCAGTCTCTAAATGGCCAACTTCAAGGTCTGTGTTACCTGTTTCTAGCACGCAAGTACACTGGGAGGATTTT
TCCTCATGGCTGAGTTCAAGATTTGCTGAAAGGCCCTTTTCAAGGTCTTTATAACACCTTTTATACACAACACAAACTCCCTATATGGCTTTCCAACTTTTAGATAATTTGGAAAAATTA
TTGGTCAGAATGATTCCTTTTCCTAATAGAAGGTTTAAAAAAAAAAATTTTATCTAACCCTTCCCTGATGGCAAAATATTTATCGCACAATCTTAATTGGCCATTTCCGTTAAGTCATGG
CTGTAAAAGTACTGGTGTATTAATGTCATTAAGTATTTAATTTCTCTTAAGCTTCATTCTTTTAAACCTGTGCTAGAATTCTCCAAAATTTGTTCATAAACTTTTCATCTTTAGGACATG
GATAACATCACAAGAGTATCTTAACATTGCTACATTTTTAAAATAATGCTAACCTGAATAGCAGGTTTTGTTTTGTTTTTTTCTGACAGACAAATCACTTAAATTCTGTATCCACTAGTT
AACTTATTATTACTTATTTATGTACTTATTGAGCCCAGATAGTAGTGAACTGGGGAGATAGCAGTGAATAATAGAAAGTCCTTGCCCTCATAGAACTTCCATTCCAGTGAGTGGAGACAA
ACAGTAAACAAGTTTATTAAGTGGTGATAACAGGTGCTACAGGGAAGAATCAAGCACAGATGGGGAGAATAACAGCACAGGGGTGGGAGAGTGACTGTCAAGGAATGCCTGTCTATGAAG
GGACCTTTGGAGAAAAACACAGAGAAGATGTGACCAAGGCATGTATACTTGTGAGGGACGAGCACTATAGGCAGAAGGAGCAGTTAGTGCAAGAAACTGGGCCTACAAGTGAGCTTGGCA
TGTTGGAGGAATACAAGGAAAGCTAGCATGCTTGGAGAAGAAGCTGCAGAAGGTGGGGTGAGGGACAAGAGATGAGAGGAGGCAGGATTCCATCACACAGGGCTTGCAGGCCATGATACT
CAGAATTAAATGTAAAGTGTGGTGGCCAGCTGTTACTGGGTTTAAAACAGGACTGTTTCTTGTTAAGATGGGGGAACTGCTTTCCTGCCAAAAGTGCCAAAGATCAACTTGGAAAACAAA
ATCCTCACAGAGGGGAGAGTAAAGAACACTTGATTAGTCTCATTAGCACCTGTAGCTACTTTTCTAAAGTTAATTCCTGAAGGCCTTGAAGCTTCACTATGAGATTGAATTTCACCATTC
TCAATGTCTTTCAATAGGATGGGGATAGTGTGATGGTCCTTCCAACCATCCCTGAAGAAGAAGCCAAAAAACTTTTCCCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAAT
ACCTCCGCTACACACCCCAGCCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTCATGGGGCATTCTCTTCTCCCACCCT
CGGGACTTTACCCCAGTGTGCACCACAGAGCTTGGCAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTCAATAGACAGTGTTGAGGACCATCTT
GCCTGGAGCAAG
GATATCAATGCTTACAATTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGATGATAGGAATCGGGAGCTTGCCATCCTGTTGGGCATGCTGGATCCAGCA
GAGAAGGATGAAAAGGGCATGCCTGTGACAGCTCGTGTG
GTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCTATCCTCTACCCAGCTACCACTGGCAGGAACTTTGATGAGATT
CTCAGGGTAGTCATCTCTCTCCAGCTGACAGCAGAAAAAAGGGTTGCCACCCCAGTTGATTGGAAG
GATGGGGATAGTGTGATGGTCCTTCCAACCATCCCTGAAGAAGAAGCCAAAAAA
CTTTTCCCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATACCTCCGCTACACACCCCAGCCTTAA

Retrieve as FASTA