Entry information : MtPrxII02 (MtPrxIIB / Medtr6g087990.1.1 [4.0])
Entry ID 4446
Creation 2007-01-30 (Nicolas Rouhier)
Last sequence changes 2016-05-17 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-05-18 (Christophe Dunand)
Peroxidase information: MtPrxII02 (MtPrxIIB / Medtr6g087990.1.1 [4.0])
Name (synonym) MtPrxII02 (MtPrxIIB / Medtr6g087990.1.1 [4.0])
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Flowers
Leaves
Mixed tissues
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrxII02
start..stop
S start..stop
MsPrxII02 326 7e-117 1..162 1..162
AhPrxII02 295 7e-105 1..162 1..162
EguPrxII03 278 8e-98 1..162 1..162
EgrPrxII03 278 8e-98 1..162 1..162
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33127365..33127519 155 N° 2 33126678..33126757 80 N° 3 33125634..33125887 254  
complement(join(33125634..33125887,33126678..33126757,33127365..33127519))


exon

Literature and cross-references MtPrxII02 (MtPrxIIB / Medtr6g087990.1.1 [4.0])
Literature The International Medicago Genome Annotation Group
Protein ref. UniProtKB_Uniparc:   Q1T4N5
DNA ref. GenBank:   AC122722.7 (99794..97639) Phytozome 11:   chr6 (33127519..33125634)
Cluster/Prediction ref. Phytozome Gene 11:   31105615 UniGene:   Mtr.3540
Omic ref. Gene atlas:   Mtr.49331.1.S1_at Legoo:   Mtr.49331.1.S1_at
Protein sequence: MtPrxII02 (MtPrxIIB / Medtr6g087990.1.1 [4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   163
PWM (Da):   %s   17479.29  
PI (pH):   %s   5.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPIKVGDVIPDGTLAFLDEENKPQSVTIHSLSAGKKVIIFAVPGAFTPTCSLKHVPGFIERSEELKGKGVDEIICIVNDPFVLNSWAKTFPENKHVKFLADGSAKYTHALGLELDLSDKGLGIRSKRFALLVEDLKVKVANVEEGGEYTISGAEEIIKAL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 exons) and 57 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAATCAAAGTCGGAGATGTGATCCCAGATGGCACCTTAGCCTTCCTTGATGAAGAAAACAAACCTCAATCTGTCACCATTCATTCCCTCTCTGCTGGCAAAAAAGTCATCATC
TTTGCTGTTCCTGGTGCCTTCACCCCCACTTGCAG
GTTAACCACTTTTCATCGTTTTTTATTTTAAAGTTTTCATTTTTATTTGATTTACGTGTTATTTAACTCAATTAGCTTCATGGGT
ACCTTTGATTCATTTGTTTTGCATTAAAGTTTTGATTTTTATTTGATTTATGTGTTATTTAACTGAATTAGCTTCATGGGTACCTTTGGTTCATTTTTTTTGCATTAAAGTTTTGATTTT
TATTTGATTTATTTGTTATTTAACTGAATTAGCTTCATGGGTACCTTTGATTTATTTTCTTTCACTTAAAGTTTTGATTTTTGATTTTTATGTGTTGGTTAAAGTTTTCATTTTTATTTG
ATTTCTGTCTTATTTGTACATATGAGATGTTACTACTGTGATCTATGAGAATTTTGAAATGGGTCACTCAAAGTTGTCTTATTTTTATTGGATCTGTTTAATTTTATTTTTTTTGAGTAA
AATTTGGGGATTTTAAGGATACTGGTTTAGGATAGAGGAACATCATGGTTGTGATATGTTTGTGTTTTGTTTCACTTTTTATAAGGTTGTCTTTACAAAATGGGGTTATGTTTCAAGAAT
TATTCAATTTGAAATCTAATTATGTTATTTTGTTTGGAACAGCTTGAAGCATGTTCCTGGCTTCATTGAGAGATCAGAAGAGCTGAAAGGAAAGGGAGTTGATGAAATCATCTGTATCAG
TG
GTAAAGTTTCTAGTCATATATCATGATTTTGTTATCTATAATGATTGTGTTGTTTATTGACAAATATTTTATGTACACCTAGTTCTTAGTTTTTACAACTTTCATGTTCAATTCAATG
TTATCTATAATGATTGTTTTGTTGCTGATTGTGTTGTTTATTGACAAATATTGTGTGTACATGTAGTTCTTAGTTTTTACAATTTTCATGTTCAATTCAAGATCCATGAATGGTTCAAAA
TTTGGGCTTGTTACTTGATTCTATATGGCTTGTTACTTGATTTGTATTGTATTTGCTGATTATTGGTTGTTGTTTGTTTTTAACATGAAGTTGAAAGCTAAATGCTTTCCTTCAATGATT
TGATTTTTGTAGTTGTTTATCTTATAATTTATATGTCTTAGATTTTCGATTCAATGTCTTGCTAAATGGTGATATGGATTCAACTATGGATTTTAATTTTTTTTATAATGTGGATCTAAC
TGTAAGCTTCGTGCCATTGGTGAATACAATGTGTTAACATCAAAGAATTTACATTCACGCATTTGTCACATCGATACCTGTTGGATCGAGATTGGAATGCCTAGATTTCAAGCTTCGTAA
TTTAGTTTTTTAAAATGATGAAAAGCTGCATTAAAATCTGGACTGTTTACTAATCTTACCGATTACAAGCAATCTGAATTTGCTAACATAATAACATGAATACATGTTCTATACTCTTGA
TGCTGGTGATCAAGTTATTGTAGGTAATTTGTCTATTACTTGACTAACTTGTGATTGTCTTTGATTTTGTAGTCAATGATCCATTTGTGCTGAATTCATGGGCCAAGACATTCCCAGAGA
ACAAGCATGTCAAGTTCCTTGCTGATGGTTCTGCCAAATACACACATGCTCTTGGGTTGGAGCTTGACCTCAGCGACAAAGGTCTTGGCATTCGCTCCAAGAGGTTTGCTCTTCTTGTTG
AAGACTTGAAGGTGAAGGTTGCAAATGTTGAAGAGGGGGGAGAATACACCATCTCCGGTGCTGAAGAAATCATCAAGGCTCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAATCAAAGTCGGAGATGTGATCCCAGATGGCACCTTAGCCTTCCTTGATGAAGAAAACAAACCTCAATCTGTCACCATTCATTCCCTCTCTGCTGGCAAAAAAGTCATCATC
TTTGCTGTTCCTGGTGCCTTCACCCCCACTTGCAG
CTTGAAGCATGTTCCTGGCTTCATTGAGAGATCAGAAGAGCTGAAAGGAAAGGGAGTTGATGAAATCATCTGTATCAGTGTCAAT
GATCCATTTGTGCTGAATTCATGGGCCAAGACATTCCCAGAGAACAAGCATGTCAAGTTCCTTGCTGATGGTTCTGCCAAATACACACATGCTCTTGGGTTGGAGCTTGACCTCAGCGAC
AAAGGTCTTGGCATTCGCTCCAAGAGGTTTGCTCTTCTTGTTGAAGACTTGAAGGTGAAGGTTGCAAATGTTGAAGAGGGGGGAGAATACACCATCTCCGGTGCTGAAGAAATCATCAAG
GCTCTTTGA

Retrieve as FASTA