Entry information : GmPrx11 (Glyma13g38300.1)
Entry ID 476
Creation 2005-06-21 (Christophe Dunand)
Last sequence changes 2011-10-10 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx11 (Glyma13g38300.1)
Name (synonym) GmPrx11 (Glyma13g38300.1)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Etiolated hypocotyls
Hypocotyls
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx11
start..stop
S start..stop
GmPrx55 652 0 1..326 1..326
GmPrx12 642 0 3..326 1..324
GmPrx86 639 0 1..326 1..326
LjPrx13 565 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39113742..39113951 210 N° 2 39113459..39113647 189 N° 3 39113157..39113319 163 N° 4 39112120..39112538 419
complement(join(39112120..39112538,39113157..39113319,39113459..39113647,3911374 2..39113951))


exon

Literature and cross-references GmPrx11 (Glyma13g38300.1)
Literature Public Soybean EST Project
DNA ref. Phytozome 12:   Gm13 (39113951..39112120)
Protein sequence: GmPrx11 (Glyma13g38300.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326
PWM (Da):   %s   35553.3  
PI (pH):   %s   8.16
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMGSNLRFLSLCLLALIASTHAQLQLGFYAQSCPKAEKIILKFVHEHIHNAPSLAAALIRMHFHDCFVRGCDGSVLLNSTTNQAEKNAPPNLTVRGFDFIDRIKSLVEAECPGVVSCADILTLAARDTIVATGGPYWKVPTGRRDGVISNLVEARNNIPAPFDNITTLQTLFANQGLDLKDLVLLSGAHTIGIAHCSSLSNRLFNFTGKGDQDPSLDSEYAANLKAFKCKDLSKLNTTKIEMDPGSRKTFDLSYYSHVIKRRGLFESDAALLTNSVTKSQIIQLLEGTVENFSAEFATSIEKMGRINVKTGTEGEIRKHCAFVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic and 22 + 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGGGAAGCAACTTGAGGTTTTTGAGTCTTTGCCTCTTGGCATTGATTGCATCAACTCATGCCCAACTTCAGCTTGGTTTTTATGCCCAGAGCTGCCCAAAAGCTGAGAAAATC
ATTTTGAAATTTGTTCATGAGCATATCCACAATGCTCCATCACTAGCAGCTGCATTGATAAGAATGCATTTCCATGATTGTTTTGTAAGG
GTATGTGGTTCAAGCCTATAATTTTCTTTC
ATTTTTTACTTAACAAGTACCATATATGTTAGATTAAAGAACTAACTAAGATGAAGTATTTCAGGGATGTGATGGATCAGTCCTTCTGAACTCAACAACCAATCAGGCTGAGAAGAATGC
TCCTCCAAATCTCACAGTAAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAAGCTGAATGCCCTGGTGTGGTCTCTTGTGCTGATATCCTCACTTTGGCTGCCAGAGACAC
TATTGTAGCCACA
GTAAGTACTCAATTGCTATCAGGAAAATCTTAAGAGTATAAGCACAACTTCTGCTTCACCTTTATTATCTTTACACTTTCTTTTTGAGAACAAGATGACCCATTTGC
TGGTTTATGCCATTACTGACATTGGTGTTCAGGGTGGACCCTATTGGAAAGTTCCAACAGGTCGAAGGGATGGGGTCATCTCTAACTTGGTGGAAGCCAGAAATAACATTCCTGCTCCAT
TTGACAACATCACTACGCTACAGACACTCTTTGCCAACCAAGGACTTGATTTGAAGGACTTGGTCCTGCTCTCTG
GTATCATTTATGAAACAAATTCCTAAGCATTATTGTTGAAAGACT
AACACGTTTTTGAGTCCCTCAATTTTGGAACAAGTTTACTTTTGGTCTTCCTAAGTTTAAAATTGATCTTTTTACTTCATGTAATTTGAAGAATATCTGTTTTAGTGTCTCTGCATAAAC
GTTGCTTATGATGTAGCCAACAAATTATAACTTGTTTACATGACAACTCACTTTGATTTTCCATTTTGAGCATAGGGACTGAAACAATTTTTTTTTCAAGTAATATGGACAAAAGCTTAA
TTTTATATTTGGAGGACAGAAAACAGATTTATCCTAAATTTAAATAACTAAAAACATATGTAATCCTGATTGAAAATATACCTAAATATTTGGAGTTTGAAATGGATAAATTTGTTTTTA
GGAATTAGTTAATTATCTTTCAAAGCTTTAGAATGCTGTTTAGATAAAGATAAAAATGAGGGTCTTGTTCTTATCATTCAGACTCGTCAATTTGTTTTTAAGATTAAAACGTTGTTAGTA
TCTGAATTTTGCGCCTCTATAAAAACCAATAAATTGGTGTGAATTATGAATTGTTCTTGTGCTAGTAATGAGCAAGAGTTCAAATTGTTTCAGGTGCTCACACAATTGGTATCGCTCATT
GTTCATCATTATCAAACCGCTTGTTCAATTTCACTGGCAAGGGTGATCAAGACCCTTCACTAGACAGTGAATATGCTGCAAATCTGAAAGCCTTCAAGTGCAAGGACCTCAGTAAATTGA
ACACCACAAAAATTGAGATGGACCCTGGAAGTCGCAAGACATTTGATCTTAGCTACTATAGTCACGTTATTAAGAGAAGGGGTCTATTTGAATCAGATGCTGCATTGTTGACTAACTCAG
TTACAAAGTCTCAAATCATCCAATTGCTTGAAGGGACAGTTGAAAATTTCTCTGCTGAGTTTGCAACCTCCATAGAGAAAATGGGAAGAATTAATGTGAAGACAGGGACAGAGGGAGAGA
TCAGGAAGCATTGTGCATTCGTAAATAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGGGAAGCAACTTGAGGTTTTTGAGTCTTTGCCTCTTGGCATTGATTGCATCAACTCATGCCCAACTTCAGCTTGGTTTTTATGCCCAGAGCTGCCCAAAAGCTGAGAAAATC
ATTTTGAAATTTGTTCATGAGCATATCCACAATGCTCCATCACTAGCAGCTGCATTGATAAGAATGCATTTCCATGATTGTTTTGTAAGG
GGATGTGATGGATCAGTCCTTCTGAACTCA
ACAACCAATCAGGCTGAGAAGAATGCTCCTCCAAATCTCACAGTAAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAAGCTGAATGCCCTGGTGTGGTCTCTTGTGCTGAT
ATCCTCACTTTGGCTGCCAGAGACACTATTGTAGCCACA
GGTGGACCCTATTGGAAAGTTCCAACAGGTCGAAGGGATGGGGTCATCTCTAACTTGGTGGAAGCCAGAAATAACATTCCT
GCTCCATTTGACAACATCACTACGCTACAGACACTCTTTGCCAACCAAGGACTTGATTTGAAGGACTTGGTCCTGCTCTCTG
GTGCTCACACAATTGGTATCGCTCATTGTTCATCATTA
TCAAACCGCTTGTTCAATTTCACTGGCAAGGGTGATCAAGACCCTTCACTAGACAGTGAATATGCTGCAAATCTGAAAGCCTTCAAGTGCAAGGACCTCAGTAAATTGAACACCACAAAA
ATTGAGATGGACCCTGGAAGTCGCAAGACATTTGATCTTAGCTACTATAGTCACGTTATTAAGAGAAGGGGTCTATTTGAATCAGATGCTGCATTGTTGACTAACTCAGTTACAAAGTCT
CAAATCATCCAATTGCTTGAAGGGACAGTTGAAAATTTCTCTGCTGAGTTTGCAACCTCCATAGAGAAAATGGGAAGAATTAATGTGAAGACAGGGACAGAGGGAGAGATCAGGAAGCAT
TGTGCATTCGTAAATAGCTAA

Retrieve as FASTA