Entry information : GmPrx12 ( Glyma13g38310)
Entry ID 477
Creation 2006-07-20 (Christophe Dunand)
Last sequence changes 2013-12-22 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-08 (Achraf Jemmat)
Peroxidase information: GmPrx12 ( Glyma13g38310)
Name (synonym) GmPrx12 ( Glyma13g38310)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Roots
Seedling epicotyls
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx12
start..stop
S start..stop
GmPrx86 656 0 1..324 3..326
GmPrx11 642 0 1..324 3..326
GmPrx55 638 0 1..324 3..326
LjPrx13 567 0 3..324 7..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39120224..39120427 204 N° 2 39119935..39120123 189 N° 3 39119632..39119794 163 N° 4 39118913..39119331 419
complement(join(39118913..39119331,39119632..39119794,39119935..39120123,3912022 4..39120427))


exon

Literature and cross-references GmPrx12 ( Glyma13g38310)
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm13 (39120674..39118913)
Protein sequence: GmPrx12 ( Glyma13g38310)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   35315.06  
PI (pH):   %s   7.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSNLRFLSLCLLALIASTHAQLQLGFYANSCPKAEQIVLKFVHDHIHNAPSLAAALIRMHFHDCFVRGCDASVLLNSTTNQAEKNAPPNLTVRGFDFIDRIKSLVEAECPGVVSCADILTLAARDTIVATGGPFWKVPTGRRDGVVSNLTEARNNIPAPSSNFTTLQTLFANQGLDLKDLVLLSGAHTIGIAHCSSLSNRLFNFTGKGDQDPSLDSEYAANLKAFKCTDLNKLNTTKIEMDPGSRKTFDLSYYSHVIKRRGLFESDAALLTNSVTKAQIIQLLEGSVENFFAEFATSIEKMGRINVKTGTEGEIRKHCAFINS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 27 ESTs. No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGCAACTTGAGGTTTTTGAGTCTTTGCCTCTTGGCATTGATTGCATCAACTCATGCTCAACTTCAGCTTGGTTTTTATGCTAACAGTTGCCCAAAAGCAGAGCAAATTGTTTTG
AAATTTGTTCATGACCATATCCACAATGCTCCATCACTAGCAGCTGCATTAATAAGAATGCACTTTCATGACTGTTTTGTAAGG
GTGTGTGCTTCAATCTTTAAGCTTCTTTCATTTTTA
CTTAACAAGTACAATGTTATTGTTAGATTAAGGTTAAGGAGCTAACTAAGATGAAGCATTTCAGGGATGTGATGCATCAGTCCTTCTGAACTCAACAACCAATCAGGCTGAGAAGAATGC
TCCTCCAAATCTCACAGTAAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAAGCTGAATGCCCTGGTGTGGTCTCTTGTGCTGATATCCTCACTTTGGCTGCCAGAGACAC
TATTGTAGCCACA
GTAAGTACTCAATTGCTATCAGGAAAATGTTAAGAGTATAAGTACAACTTCTGCTTCACCTTTAGTATCTTTACACTTTCTTTTTGAGAACAAGAATGACCCATTTG
CTGGTTTATGCCATTACTGGCATTGGCTTTCAGGGTGGACCTTTTTGGAAAGTTCCAACTGGTCGAAGGGATGGGGTCGTCTCTAACTTGACGGAAGCCAGAAATAACATTCCTGCTCCA
TCTTCCAACTTTACCACCCTACAAACACTCTTTGCTAACCAAGGACTTGATTTGAAGGACTTGGTCCTGCTCTCTG
GTACCATTTATCAAACAATTTCTCGAGTTGGAAATATGTCTAAA
TATCTGCAATTTCAACATGAATAATTTATTTTTTAGGAATTTATTAACTACATTTTAAATTTTCAGGATATTGATTTGATAATTCTTATTATTTAGACTTTAGGACACTATCAGTTTGTT
TAATTTCAAGGTTAAGATGTGTTATATTTTGAATTTTGCATTACATTATTTCATTTTAAAAAATAAAACCAACAAATTGGCATGAATTATACATTGTTCTTGGGCTTGTAATGAGCAAGA
GTTCAAATTGTTTCAGGTGCTCACACAATTGGTATCGCTCATTGCTCATCATTATCAAACCGGTTGTTCAATTTCACTGGCAAGGGTGATCAAGACCCGTCACTAGATAGTGAATATGCT
GCAAATTTGAAAGCATTCAAGTGCACAGACCTCAACAAGTTGAACACCACAAAAATTGAGATGGACCCTGGAAGTCGCAAGACATTTGATCTTAGCTACTATAGTCACGTTATTAAGAGA
AGGGGTCTATTTGAGTCAGATGCTGCATTATTGACTAACTCAGTTACAAAGGCACAAATCATCCAATTGCTTGAAGGGTCAGTTGAAAATTTCTTTGCTGAGTTTGCAACCTCCATCGAG
AAAATGGGAAGAATTAATGTGAAGACAGGGACAGAAGGAGAGATCAGGAAGCATTGTGCATTTATAAATAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGCAACTTGAGGTTTTTGAGTCTTTGCCTCTTGGCATTGATTGCATCAACTCATGCTCAACTTCAGCTTGGTTTTTATGCTAACAGTTGCCCAAAAGCAGAGCAAATTGTTTTG
AAATTTGTTCATGACCATATCCACAATGCTCCATCACTAGCAGCTGCATTAATAAGAATGCACTTTCATGACTGTTTTGTAAGG
GGATGTGATGCATCAGTCCTTCTGAACTCAACAACC
AATCAGGCTGAGAAGAATGCTCCTCCAAATCTCACAGTAAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAAGCTGAATGCCCTGGTGTGGTCTCTTGTGCTGATATCCTC
ACTTTGGCTGCCAGAGACACTATTGTAGCCACA
GGTGGACCTTTTTGGAAAGTTCCAACTGGTCGAAGGGATGGGGTCGTCTCTAACTTGACGGAAGCCAGAAATAACATTCCTGCTCCA
TCTTCCAACTTTACCACCCTACAAACACTCTTTGCTAACCAAGGACTTGATTTGAAGGACTTGGTCCTGCTCTCTG
GTGCTCACACAATTGGTATCGCTCATTGCTCATCATTATCAAAC
CGGTTGTTCAATTTCACTGGCAAGGGTGATCAAGACCCGTCACTAGATAGTGAATATGCTGCAAATTTGAAAGCATTCAAGTGCACAGACCTCAACAAGTTGAACACCACAAAAATTGAG
ATGGACCCTGGAAGTCGCAAGACATTTGATCTTAGCTACTATAGTCACGTTATTAAGAGAAGGGGTCTATTTGAGTCAGATGCTGCATTATTGACTAACTCAGTTACAAAGGCACAAATC
ATCCAATTGCTTGAAGGGTCAGTTGAAAATTTCTTTGCTGAGTTTGCAACCTCCATCGAGAAAATGGGAAGAATTAATGTGAAGACAGGGACAGAAGGAGAGATCAGGAAGCATTGTGCA
TTTATAAATAGCTAA

Retrieve as FASTA