Entry information : GmPrx24 (Glyma09g02670.1)
Entry ID 494
Creation 2006-01-18 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx24 (Glyma09g02670.1)
Name (synonym) GmPrx24 (Glyma09g02670.1)
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Germinating seeds
Hypocotyls
Mature flowers
Plumules
Seedlings
Inducer Sudden Death Syndrome disease
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx24
start..stop
S start..stop
GmPrx262 629 0 1..322 1..322
GmPrx47 583 0 1..350 1..347
MtPrx26 563 0 7..350 10..353
PvPrx08 553 0 3..350 8..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1815592..1815804 213 N° 2 1816605..1816796 192 N° 3 1817030..1817195 166 N° 4 1817701..1818182 482
join(1815592..1815804,1816605..1816796,1817030..1817195,1817701..1818182)


exon

Literature and cross-references GmPrx24 (Glyma09g02670.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 11:   Gm09 (1815592..1818182)
Protein sequence: GmPrx24 (Glyma09g02670.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351
PWM (Da):   %s   37454.56  
PI (pH):   %s   4.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLRLALCCVVVVLGALPHFSYAQLDPSFYDSTCSNVTSIVREVLSNVSQSDPRILASLIRLHFHDCFVQGCDASILLNDTDTIVSEQSAVPNNNSIRGLDVVNQIKTAVENACPGIVSCADILALAAQISSDLANGPVWQVPLGRRDSLTANQTLANQNLPAPTFTIDQLIESFGNQSLNITDLVALSGAHTIGRAQCRFFVDRLYNFSNTGNPDPTLNTTLLQSLQGICPNGGPGTNLTNLDLTTPDTFDSNYYSNLQLQNGLLQSDQELLSANNTDIVAIVNNFISNQTLFFENFKASMIKMGNIGVLTGSQGEIRSQCNSVNGNSSGLTTTATKESSQDSMVSSL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCCCTTCGTCTGGCTTTATGCTGTGTGGTGGTAGTGCTTGGAGCACTACCACACTTCTCATATGCACAGCTAGATCCTTCATTTTACGATAGCACATGTTCAAATGTGACTTCA
ATCGTACGTGAGGTGCTCTCAAATGTCTCCCAGTCTGATCCCCGCATACTTGCAAGTCTCATCAGGCTCCATTTTCACGACTGTTTTGTTCAG
GTAACTATATATAATTACTCTTCTTCA
TATCTTAATTAACTCCATTCATAGTTAATTTCTTGCCACATGCAGCTAATTAGTTAACTCTTATCACGTCTTTTGATTTTAGAGTAGTAAATCCTTCCCTACTTCTATTACCCCGAGCAA
AACTCGTTTATCAAATTAGTAATATTTTTTCTTTTATATTAGATGGCTAAAATGCAAGGGTTCATGAAAACATTTCTATANNNNNNNNNNNNNNNNNNNNNNNNNTGTGTTTGATTTATC
AAATTTTCAAAAGCTGTTTTCATTGAGAAGTAATTTAAATGAATATCTTTTATTGATCTTTTATACAAAATACATTGATACATCATAATACATAGAAGTGGTTGTACAATAGATTGGATT
TTAGTGTGCGTCTCCCCTATGAGTAACGACTATTTGAAATATAAATTCAAAATAACATCAAGTAATAAATAATTTTAAAATACTTATTTTAGAAATAATTTATAACACTTAATAGATTTT
CATAATTTCTGAGAACGGAATCAATCATGCACCTGGTCTCCTCCATCAATTTTAGTGAAATCTTTTTCCACTCCAAGTTATGAACTGGGGCCTCTGGCTCAACCACTCCTTATAATGTTA
AGTGTAAAAGCAAACGTGGTTTGAAATGTCAAGGTTTCCTTATCTTGGGCACTGATAAAAGAGTACGTTGAATAAAAGAAAAGGAAAAATAAAGTGCACGTTGCTTTTTAATGTAACTCA
ATTATTTTGTTGCTGAGAGAATTGAATTAATTATACATGGATGGATATGACAGGGGTGTGACGCATCAATTCTGCTGAACGACACGGACACGATCGTGAGCGAGCAAAGTGCAGTGCCAA
ACAACAACTCAATAAGAGGTTTGGATGTTGTGAACCAGATCAAGACTGCAGTGGAAAATGCTTGTCCCGGCATAGTTTCTTGTGCTGATATTCTTGCTCTTGCAGCTCAAATATCTTCTG
ATCTG
GTATAAATAAATATATATATATATATGAAGAATTGATTAAAACAAATCATCGTCAAGAATATAAAAAAATAAAAAATAAATAAAAACTTCGTGGAATTTTAATCTTAATTGAAAC
CATAACTTCTCAACAATTTTTGTTCACCTTTTGAATTCTATTTTGTCCAACTTATAGAGTTTTAGTATTTTTTGATGCATTTATATATAGAGTTTTAGTATAACTATATATTTGGCAGGC
TAATGGTCCTGTTTGGCAAGTTCCATTGGGAAGAAGGGATAGTTTGACAGCAAATCAAACCCTTGCTAACCAAAATCTTCCGGCTCCTACTTTTACCATTGATCAACTTATCGAATCATT
TGGTAATCAAAGCCTCAACATTACTGATCTAGTTGCACTTTCAG
GTATGAAAGCTTTTACATTTAATAAATAAAATGTTTTATAATTTGTATTTACGAGTGTATAGTATTTTTTGGATTT
TTATGAAATCAGTGAGAATTTATTGATTATCTTTAATAGGATATTTTCTCTTAATCACTATAAGACTTGAGCTAGTTAGGGATCCAAACTTAGTTTGACTAGAACCAAGGACATAATATT
AAATATATCTTCTTATATGCTTTATATTGTTTAAATAAAAAAAAAACTAAATGACGATGAGTTTTTTTTGTGTGATCATATTGCTACTCTTATAATAATACTTAAACTAATTCTAATTTA
GATAACTTGGATGAAAATTAATTAAACAACAGTAGCAATGTTTATAATCAAATGACAATGAATGCTCTCTTTTGATATAAATACATTCTTTTTTTATAAAAAAAATTATCGTTATACATC
TTTAGTATCATGTGTACCCATTAGAAAACCCTTTAATTGCATTACTTATTGAAATTTTTCTTTTTTTAGGTGCTCATACAATTGGTAGAGCTCAATGCAGATTTTTTGTTGATCGATTAT
ACAATTTCAGCAACACTGGCAACCCAGATCCTACTCTAAACACAACTCTCTTACAATCATTGCAAGGAATATGTCCAAATGGTGGACCTGGCACTAATCTCACCAATTTGGACTTAACCA
CTCCAGACACATTCGACTCCAACTATTACTCCAATCTTCAACTTCAAAATGGCTTGCTTCAGAGTGATCAAGAGTTGCTTAGTGCAAATAATACGGATATCGTTGCCATTGTCAACAATT
TCATTAGTAACCAAACTCTTTTCTTTGAAAACTTTAAGGCGTCAATGATAAAAATGGGCAACATTGGAGTGCTAACGGGATCACAAGGAGAAATCCGATCGCAATGTAATTCTGTGAATG
GAAATTCTTCCGGACTTACTACTACTGCCACCAAAGAATCATCACAAGATAGCATGGTTAGCTCATTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCCCTTCGTCTGGCTTTATGCTGTGTGGTGGTAGTGCTTGGAGCACTACCACACTTCTCATATGCACAGCTAGATCCTTCATTTTACGATAGCACATGTTCAAATGTGACTTCA
ATCGTACGTGAGGTGCTCTCAAATGTCTCCCAGTCTGATCCCCGCATACTTGCAAGTCTCATCAGGCTCCATTTTCACGACTGTTTTGTTCAG
GGGTGTGACGCATCAATTCTGCTGAAC
GACACGGACACGATCGTGAGCGAGCAAAGTGCAGTGCCAAACAACAACTCAATAAGAGGTTTGGATGTTGTGAACCAGATCAAGACTGCAGTGGAAAATGCTTGTCCCGGCATAGTTTCT
TGTGCTGATATTCTTGCTCTTGCAGCTCAAATATCTTCTGATCTG
GCTAATGGTCCTGTTTGGCAAGTTCCATTGGGAAGAAGGGATAGTTTGACAGCAAATCAAACCCTTGCTAACCAA
AATCTTCCGGCTCCTACTTTTACCATTGATCAACTTATCGAATCATTTGGTAATCAAAGCCTCAACATTACTGATCTAGTTGCACTTTCAG
GTGCTCATACAATTGGTAGAGCTCAATGC
AGATTTTTTGTTGATCGATTATACAATTTCAGCAACACTGGCAACCCAGATCCTACTCTAAACACAACTCTCTTACAATCATTGCAAGGAATATGTCCAAATGGTGGACCTGGCACTAAT
CTCACCAATTTGGACTTAACCACTCCAGACACATTCGACTCCAACTATTACTCCAATCTTCAACTTCAAAATGGCTTGCTTCAGAGTGATCAAGAGTTGCTTAGTGCAAATAATACGGAT
ATCGTTGCCATTGTCAACAATTTCATTAGTAACCAAACTCTTTTCTTTGAAAACTTTAAGGCGTCAATGATAAAAATGGGCAACATTGGAGTGCTAACGGGATCACAAGGAGAAATCCGA
TCGCAATGTAATTCTGTGAATGGAAATTCTTCCGGACTTACTACTACTGCCACCAAAGAATCATCACAAGATAGCATGGTTAGCTCATTGTAA

Retrieve as FASTA