Entry information : Gz1CysPrx
Entry ID 4977
Creation 2007-03-11 (Nicolas Rouhier)
Last sequence changes 2007-03-11 (Nicolas Rouhier)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: Gz1CysPrx
Name Gz1CysPrx
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Gz1CysPrx
start..stop
S start..stop
Pno1CysPrx02 395 6e-142 6..222 7..223
Mgr1CysPrx 379 1e-135 4..221 7..224
Nc1CysPrx 370 3e-132 5..221 8..224
Dh1CysPrx 361 1e-128 7..218 9..220
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3786194..3786534 341 N° 2 3785804..3786143 340  
complement(join(3785804..3786143,3786194..3786534))


exon

Literature and cross-references Gz1CysPrx
Literature Birren B. et al.

Fusarium graminearum genome sequence

Unpublished

Submitted (03-FEB-2004)
Protein ref. UniProtKB_Uniparc:   Q4I5H2
DNA ref. JGI genome:   Supercontig_3.4 (3786534..3785804)
mRNA ref. GenBank:   EAA76884
Protein sequence: Gz1CysPrx
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   226
PWM (Da):   %s   25175.17  
PI (pH):   %s   6.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAPAPLRLGSTAPNFQAETTKGNIDFHEFIGDNWVILFSHPEDYTPVCTTELGAFAKLQPEFTKRNVKLIGLSANTIQSHEGWIKDIGEVTGGNVEFPIIGDKERKVSLLYDMIDQQDATNVDEKGIAFTIRSVFIIDPKKTIRTIFSYPASTGRNAAEVLRVIDSLQTGDKYRITTPINWVPGEDVIVHPSVKNEEAKTLFPEFRIVKPYLRFTPLAKEKVLPQ

Retrieve as FASTA  
Remarks Genomic (1 intron, Chromo 4). Strain="PH-1 / NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTCCTGCTCCTCTTCGTCTGGGCTCTACCGCCCCCAACTTCCAGGCCGAGACCACAAAGGGAAACATTGACTTCCACGAGTTCATCGGCGACAACTGGGTCATCCTCTTCTCC
CACCCCGAGGACTACACCCCCGTCTGCACCACTGAGCTCGGTGCCTTTGCCAAGCTCCAGCCCGAGTTCACCAAGCGCAACGTCAAGCTCATCGGTCTCTCCGCCAACACCATCCAGTCC
CACGAGGGATGGATCAAGGACATTGGTGAGGTTACTGGCGGCAACGTCGAGTTCCCCATCATTGGTGACAAGGAGCGCAAGGTTTCTCTTCTCTACGACAT
GTAAGAACTATCTGTCTAC
TATTCTCCCTACAAAAACTGACAATCCACAGGATCGACCAGCAGGATGCTACCAACGTCGATGAGAAGGGCATTGCCTTCACCATCCGATCCGTCTTCATCATCGACCCCAAGAAGACCA
TCCGCACCATCTTCTCCTACCCTGCCTCCACCGGCCGCAACGCCGCCGAGGTCCTCCGCGTCATCGACTCCCTCCAGACCGGTGACAAGTACCGCATCACCACCCCTATCAACTGGGTCC
CTGGTGAGGACGTCATTGTCCACCCCTCCGTCAAGAACGAGGAGGCCAAGACTCTGTTCCCCGAGTTCCGCATCGTCAAGCCTTACCTCCGATTCACCCCTCTCGCCAAGGAGAAGGTCC
TCCCCCAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTCCTGCTCCTCTTCGTCTGGGCTCTACCGCCCCCAACTTCCAGGCCGAGACCACAAAGGGAAACATTGACTTCCACGAGTTCATCGGCGACAACTGGGTCATCCTCTTCTCC
CACCCCGAGGACTACACCCCCGTCTGCACCACTGAGCTCGGTGCCTTTGCCAAGCTCCAGCCCGAGTTCACCAAGCGCAACGTCAAGCTCATCGGTCTCTCCGCCAACACCATCCAGTCC
CACGAGGGATGGATCAAGGACATTGGTGAGGTTACTGGCGGCAACGTCGAGTTCCCCATCATTGGTGACAAGGAGCGCAAGGTTTCTCTTCTCTACGACAT
GATCGACCAGCAGGATGCT
ACCAACGTCGATGAGAAGGGCATTGCCTTCACCATCCGATCCGTCTTCATCATCGACCCCAAGAAGACCATCCGCACCATCTTCTCCTACCCTGCCTCCACCGGCCGCAACGCCGCCGAG
GTCCTCCGCGTCATCGACTCCCTCCAGACCGGTGACAAGTACCGCATCACCACCCCTATCAACTGGGTCCCTGGTGAGGACGTCATTGTCCACCCCTCCGTCAAGAACGAGGAGGCCAAG
ACTCTGTTCCCCGAGTTCCGCATCGTCAAGCCTTACCTCCGATTCACCCCTCTCGCCAAGGAGAAGGTCCTCCCCCAGTAA

Retrieve as FASTA