Entry information : MtPrx97 (Medtr2g084110.1[4.0] / Medtr2g097980.1[3.0])
Entry ID 5088
Creation 2007-03-27 (Christophe Dunand)
Last sequence changes 2007-03-27 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-31 (Messaoudi)
Peroxidase information: MtPrx97 (Medtr2g084110.1[4.0] / Medtr2g097980.1[3.0])
Name (synonym) MtPrx97 (Medtr2g084110.1[4.0] / Medtr2g097980.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx97
start..stop
S start..stop
MtPrx57 616 0 1..317 1..317
PsPrx11 553 0 1..317 1..318
MtPrx43 548 0 1..317 1..318
MtPrx28 548 0 1..317 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35323079..35323288 210 N° 2 35322781..35322972 192 N° 3 35322094..35322645 552  
complement(join(35322094..35322645,35322781..35322972,35323079..35323288))


exon

Literature and cross-references MtPrx97 (Medtr2g084110.1[4.0] / Medtr2g097980.1[3.0])
Literature Town,C.D., Tallon,L.J., Jones,K., Hine,E., Arfsten,K., Wilhelm,K., Monaghan,E., Fadrosh,D.W., Koo,H., Cheung,F., Shetty,J., Viswanathan,L.D. and Ferriera,S. Medicago truncatula BAC genomic sequence.
DNA ref. Phytozome 11:   chr2 (35323288..35322094)
Cluster/Prediction ref. Phytozome Gene 11:   31065100
Protein sequence: MtPrx97 (Medtr2g084110.1[4.0] / Medtr2g097980.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   34226.26 (31766.0)  
PI (pH):   %s   8.48 (8.39) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATFTKLFVTLSIFSLLACSTNAQLVNNFYGRTCPSLQTIVRREMANAIKTEARIGASILRLFFHDCFVNGCDGSILLDDTATFTGEKNAAPNKNSARGFEVIDTIKTSVEASCNATVSCADILALAARDGVFLLGGPTWVVPLGRRDARTASQSAANSQIPSPFSDLSTLTKMFTDKGLTASDLTVLSGAHTIGQGECQFFRNRIYNETNIDTNFATLRKLNCPLSGGDTNLAPLDTLTPTNFDNNYYKNLVASKGLFHSDQALFNNGSQDNLVRSYSTNGATFRRDFAVAMVKLSKINPLTGTNGEIRKNCRLVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 2, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCTTTACAAAATTATTTGTTACACTCTCCATTTTTTCTCTCCTAGCTTGTTCTACCAACGCACAACTTGTTAATAACTTCTATGGAAGAACTTGCCCTAGCCTCCAAACCATA
GTGCGCAGGGAAATGGCCAATGCTATCAAAACTGAAGCCCGGATTGGGGCTTCTATACTTCGCTTGTTCTTCCATGATTGTTTTGTAAAT
GTAAGATAATGTTCAAAAATAATTTATTTA
TGCATTATATATATGGGGTATATTTTTAAAAAATTGTATAATCACATTTTTATTTATTTCTATGTTTATTTTGTAGGGATGTGATGGATCAATTTTATTGGATGACACTGCCACCTTTAC
CGGTGAGAAAAATGCCGCACCTAACAAAAACTCAGCTAGGGGTTTCGAAGTGATTGATACCATTAAAACTAGTGTTGAAGCTTCATGCAATGCCACTGTATCTTGTGCTGATATTCTAGC
ACTTGCAGCAAGAGATGGAGTATTTCTG
GTGAGTGGTCCATTACTCCATGCCAATTACTTTCTTCTGATGCAAAACATATTAGAAAAAATTATACTCCGTCTAGCTGAGAGAAACTTGAG
TTACACTTTCTCCCATATTAATAGTTTTATTTTTTATTTGTAGCTTGGAGGACCAACATGGGTAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGCCAAAGTGCAGCAAATAGTCA
AATCCCTTCACCATTTTCTGACCTTTCCACTCTCACCAAAATGTTTACAGACAAGGGTCTAACTGCAAGTGACCTCACAGTACTTTCTGGTGCACACACCATAGGCCAAGGAGAGTGCCA
ATTTTTCAGAAATCGCATATACAATGAAACCAACATTGACACAAACTTTGCAACCTTAAGGAAATTAAATTGTCCTCTTTCTGGTGGTGACACCAATTTAGCACCTCTTGACACTCTCAC
TCCAACAAATTTTGACAACAATTACTATAAAAATCTTGTTGCAAGCAAAGGTCTTTTCCATTCTGATCAAGCTCTTTTCAATAATGGGTCTCAAGATAATTTGGTTAGGAGTTATAGTAC
CAATGGTGCTACTTTTAGAAGAGACTTTGCTGTTGCTATGGTGAAACTGAGTAAAATTAATCCTCTAACTGGGACTAATGGGGAGATTAGAAAGAATTGTAGGCTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCTTTACAAAATTATTTGTTACACTCTCCATTTTTTCTCTCCTAGCTTGTTCTACCAACGCACAACTTGTTAATAACTTCTATGGAAGAACTTGCCCTAGCCTCCAAACCATA
GTGCGCAGGGAAATGGCCAATGCTATCAAAACTGAAGCCCGGATTGGGGCTTCTATACTTCGCTTGTTCTTCCATGATTGTTTTGTAAAT
GGATGTGATGGATCAATTTTATTGGATGAC
ACTGCCACCTTTACCGGTGAGAAAAATGCCGCACCTAACAAAAACTCAGCTAGGGGTTTCGAAGTGATTGATACCATTAAAACTAGTGTTGAAGCTTCATGCAATGCCACTGTATCTTGT
GCTGATATTCTAGCACTTGCAGCAAGAGATGGAGTATTTCTG
CTTGGAGGACCAACATGGGTAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGCCAAAGTGCAGCAAATAGTCAA
ATCCCTTCACCATTTTCTGACCTTTCCACTCTCACCAAAATGTTTACAGACAAGGGTCTAACTGCAAGTGACCTCACAGTACTTTCTGGTGCACACACCATAGGCCAAGGAGAGTGCCAA
TTTTTCAGAAATCGCATATACAATGAAACCAACATTGACACAAACTTTGCAACCTTAAGGAAATTAAATTGTCCTCTTTCTGGTGGTGACACCAATTTAGCACCTCTTGACACTCTCACT
CCAACAAATTTTGACAACAATTACTATAAAAATCTTGTTGCAAGCAAAGGTCTTTTCCATTCTGATCAAGCTCTTTTCAATAATGGGTCTCAAGATAATTTGGTTAGGAGTTATAGTACC
AATGGTGCTACTTTTAGAAGAGACTTTGCTGTTGCTATGGTGAAACTGAGTAAAATTAATCCTCTAACTGGGACTAATGGGGAGATTAGAAAGAATTGTAGGCTTGTGAATTGA

Retrieve as FASTA