Entry information : GmPrx25 (Glyma11g05300.1)
Entry ID 509
Creation 2005-11-09 (Christophe Dunand)
Last sequence changes 2011-07-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx25 (Glyma11g05300.1)
Name (synonym) GmPrx25 (Glyma11g05300.1)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Etiolated hypocotyls
Hypocotyls
Immature pods
Mature flowers
Roots
Inducer Phytophthora infection
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx25
start..stop
S start..stop
GmPrx104 655 0 1..328 1..328
MtPrx42 586 0 1..328 1..328
MsPrx16 570 0 4..328 1..325
TrPrx02 532 0 5..328 6..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3711375..3711590 216 N° 2 3711030..3711230 201 N° 3 3710750..3710915 166 N° 4 3709587..3709990 404
complement(join(3709587..3709990,3710750..3710915,3711030..3711230,3711375..3711 590))


exon

Literature and cross-references GmPrx25 (Glyma11g05300.1)
Literature Public Soybean EST Project.
DNA ref. Phytozome 11:   Gm11 (3711590..3709587)
Protein sequence: GmPrx25 (Glyma11g05300.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329
PWM (Da):   %s   36182.37  
PI (pH):   %s   8.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQLNLILIWLFLLSLCLYSCPTSAQLSRHHYAKTCPNVENIVREAVKKKFHQTFVTVPATIRLFFHDCFVQGCDASVLVASTKNNKAEKDHPDNVSLAGDGFDTVIKAKEAVDAVPLCRNKVSCADILALATRDVIELAGGPFYEVELGRFDGLRSKDSDVNGRLPHPEFNLNQLNSLFAANGLTQTEMIALSGAHTVGFSHCNKFTNRVYNFKSKSRVDPTLNEKYATQLKSMCPRNVDPRIAIDMDPSTPRSFDNVYFKNLQQGKGLFSSDQVLFTDSRSKATVNAFASSSKIFHANFAAAMTKLGRVGIKNAQNGNIRTDCSVI

Retrieve as FASTA  
Remarks Complete sequence from genomic and 12 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAGCTTAACCTCATACTTATCTGGTTATTTTTATTGAGTCTGTGCCTTTATTCATGTCCTACTTCGGCCCAGTTAAGTAGACACCACTATGCAAAAACATGCCCCAATGTTGAA
AACATTGTCAGAGAAGCAGTCAAAAAGAAGTTTCATCAAACATTTGTTACGGTTCCTGCTACCATTCGTCTCTTCTTCCATGATTGCTTCGTGCAG
GTAATCAATCAATTGCATGCATTT
CATTCATTCACCATATAAATGCTAAAAAGAAAGTAAAAGAGAAAATCCCCCCATTAATCACAGTATCTTCTAGCTGAACAAATCAAATTCTATTTATGCTTTGTTTGTAATATTACACAG

GGTTGTGATGCCTCGGTTTTGGTTGCATCCACAAAAAACAACAAAGCAGAGAAGGATCACCCAGATAATGTTTCACTAGCTGGAGATGGATTTGACACAGTGATTAAAGCAAAAGAAGCA
GTTGATGCAGTTCCATTGTGCAGGAACAAAGTTTCATGTGCTGATATTTTAGCCTTGGCAACCCGTGATGTTATTGAACTG
GTTTGTTTGTTCATGAATTACTCTTACTTTAATTGAAAA
AACATTTGATTTTAGTGATGTGAGACTGTGAGTAATAAGGAGCTTTGTTGAATTATAATGGAATTGCATCTTCAGGCCGGTGGGCCTTTCTACGAGGTTGAATTGGGAAGATTTGATGGG
CTAAGATCTAAAGATTCAGATGTAAACGGGAGGCTGCCTCATCCAGAGTTCAACTTGAACCAGCTCAATTCACTGTTTGCGGCCAACGGTCTCACCCAAACGGAAATGATAGCTCTATCA
G
GTAATGCGCGTGCTCTGCACTTTCCAGCCAAATAATTGGATTCTAAACATGTGTCTTCACTCTTCACACATGATCTGTGTTCCCCAGTGAATCCCATTATTGGGTTTCAAAGTAACGGG
TACATTTTATGAATTTAAATTTGATCCACTATCTTTCAACTCCCAATCATGTCTTAGTATGTTATTTAAAAAATATAATCAAATCTAAGTATGTGAATTAATCAACATGTTGTTAACTAG
TTTAAACTCTTTAAATAAATTTTTAGGTTCGAATATTAGTTACTAACAAAAACAAAATCAGTAAATATTTGTATTGCTTTTATTCTTATTAAATGCATAATTATAAATAAATTTTATACT
TAGTACTAACATTGGACAGAAATTAATCTTTTGAAAAAGGTTTCGTAGAAAAATTTTGAATCCTCTTATTAATCTCTCAACTTTTTTTTATATGAGAGGTATTGAATATTCTTTACATTT
TTAAGTTATTGATATTTTTATTTAATATTTATTTATAAGATGGTAGAAAGTTTTGTAGAAGAATAGAACATCACTTAGTTTAGTATTCTTGAATTGCTTTATTAAACAAGAATGCAAAAT
ACTGAATAAATATAACTTAGTGTAGGATTATTTTCCTAATGGATATATGAAATTTCGTTCTTGAAAAAATTCAAAAAGAGATATCATGGGGGATGAATGAAAAAGAAAAGTCAAGGTAAT
CATAGTTTGATTTCTTTTTGATAAATGATTCACACTACAGGTGCTCACACTGTTGGATTCTCCCATTGCAACAAATTCACGAACAGAGTATACAATTTCAAGAGCAAAAGTCGAGTGGAC
CCTACACTGAACGAGAAATACGCAACACAGCTAAAGTCAATGTGCCCAAGGAATGTGGATCCAAGGATTGCAATCGATATGGACCCAAGCACTCCACGGTCATTCGACAATGTTTATTTC
AAGAATCTTCAGCAAGGGAAGGGCCTCTTCTCTTCAGACCAAGTTCTCTTCACGGACTCAAGATCCAAGGCCACTGTAAATGCATTTGCTAGTAGCAGCAAAATCTTCCATGCCAACTTC
GCCGCTGCTATGACCAAATTGGGCCGAGTTGGAATCAAGAATGCACAGAATGGAAACATTCGCACCGATTGTTCAGTCATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCAGCTTAACCTCATACTTATCTGGTTATTTTTATTGAGTCTGTGCCTTTATTCATGTCCTACTTCGGCCCAGTTAAGTAGACACCACTATGCAAAAACATGCCCCAATGTTGAA
AACATTGTCAGAGAAGCAGTCAAAAAGAAGTTTCATCAAACATTTGTTACGGTTCCTGCTACCATTCGTCTCTTCTTCCATGATTGCTTCGTGCAG
GGTTGTGATGCCTCGGTTTTGGTT
GCATCCACAAAAAACAACAAAGCAGAGAAGGATCACCCAGATAATGTTTCACTAGCTGGAGATGGATTTGACACAGTGATTAAAGCAAAAGAAGCAGTTGATGCAGTTCCATTGTGCAGG
AACAAAGTTTCATGTGCTGATATTTTAGCCTTGGCAACCCGTGATGTTATTGAACTG
GCCGGTGGGCCTTTCTACGAGGTTGAATTGGGAAGATTTGATGGGCTAAGATCTAAAGATTCA
GATGTAAACGGGAGGCTGCCTCATCCAGAGTTCAACTTGAACCAGCTCAATTCACTGTTTGCGGCCAACGGTCTCACCCAAACGGAAATGATAGCTCTATCAG
GTGCTCACACTGTTGGA
TTCTCCCATTGCAACAAATTCACGAACAGAGTATACAATTTCAAGAGCAAAAGTCGAGTGGACCCTACACTGAACGAGAAATACGCAACACAGCTAAAGTCAATGTGCCCAAGGAATGTG
GATCCAAGGATTGCAATCGATATGGACCCAAGCACTCCACGGTCATTCGACAATGTTTATTTCAAGAATCTTCAGCAAGGGAAGGGCCTCTTCTCTTCAGACCAAGTTCTCTTCACGGAC
TCAAGATCCAAGGCCACTGTAAATGCATTTGCTAGTAGCAGCAAAATCTTCCATGCCAACTTCGCCGCTGCTATGACCAAATTGGGCCGAGTTGGAATCAAGAATGCACAGAATGGAAAC
ATTCGCACCGATTGTTCAGTCATTTAA

Retrieve as FASTA