Entry information : PoDyPrx01_PC15
Entry ID 5099
Creation 2007-03-29 (Filippo Passardi)
Last sequence changes 2012-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: PoDyPrx01_PC15
Name PoDyPrx01_PC15
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoDyPrx01_PC15
start..stop
S start..stop
PoDyPrx01_other 1063 0 1..516 1..525
PoDyPrx02_PC15 706 0 1..516 1..511
PoDyPrx03_PC15 634 0 40..516 4..479
PstrDyPrx01 452 6e-156 31..516 33..505
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 213879..214011 133 N° 2 214064..214166 103 N° 3 214225..214328 104 N° 4 214383..214756 374
N° 5 214818..215014 197 N° 6 215067..215151 85 N° 7 215205..215433 229 N° 8 215485..215541 57
N° 9 215600..215666 67 N° 10 215721..215922 202  
join(213879..214011,214064..214166,214225..214328,214383..214756,214818..215014, 215067..215151,215205..215433,215485..215541,215600..215666,215721..215922)


exon

Literature and cross-references PoDyPrx01_PC15
Literature Giardina,P., Faraco,V., Palmieri,G., Piscitelli,A. and Sannia,G.;
Sequence analysis of a new member of the dye-decolorizin peroxidase family (DyP). Unpublished. Submitted (20-JUN-2006).

DNA ref. JGI genome:   scaffold_09 (213879..215922)
Protein sequence: PoDyPrx01_PC15
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   516 (497)
PWM (Da):   %s   57135.5 (54900.3)  
PI (pH):   %s   5.63 (5.44) Peptide Signal:   %s   cut: 33 range:20-516
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRWWTTCVALTSLVPYTLLPSYGFSLPQQLEARQNDYPSGSLLHDYPGQHTLPTLELIQKLNATNGTFLPLEEIQGDIMIGMRKPKEIFFFYSIQNPRKFKSVLAKLIYPHITTAQMVCTTCTQPSAMLNVAWTSQGLRKLGVLDDLGDPYFAMGQLNDAAALGDTDPSTTWAPGLYANKTDGAFLIAARDWEPIDTLLNQMKNWLGDAIVETHSNRGAVRPGDAAGKEHFGWLDGIQPAVAGFATSTYPGQQLLLPGTLLTKEIGDPRRAARPAWTKWGSFMAYRQLQELVPEFDDYLMQEAALIQDSSRSVRERADLLGARMFGRWKGTPLDLAPERDDPSIGPNLMLNNNFDFNHPAPFDINSNQSYCPFSAHIRKIRPRADQGNTNLKNQMIRASIPYGEELSDDEINSKKTATERGVAFVTYQSDLGSGFHFQQAEWANNVNIPTGKSDPTPGFDPIVGQNNGKPLVVSGIDYTDLNHDLTFMSFVVSKGGDYFFSPSMSAILHKIAA

Retrieve as FASTA  
Remarks Complete sequence from Genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGTGGACTACCTGCGTCGCTCTCACTTCGTTAGTACCTTACACCCTCCTGCCCAGTTATGGGTTCAGTCTGCCCCAGCAGCTCGAGGCGAGGCAGAACGACTATCCGAGTGGA
TCACTGTTACACG
GCGAGTTGCACTATTTCCTGCCAAGATGGCGTGCTCACTCGCCTACCCGTAGATTATCCTGGGCAACATACATTGCCAACGCTTGAGTTGATCCAGAAATTGAATGC
CACTAATGGCACATTCCTTCCGCTGGAGGAGATTCAAGGAGACATCAT
GTACGCATTCCGATCGCTTGAAGTCGTGTGCTGTGTCCATAACGCACTGTCTCCCTAGGATTGGGATGAGGA
AGCCGAAGGAAATATTCTTTTTCTACTCGATTCAGAACCCAAGAAAGTTCAAGAGTGTCCTCGCGAAACTGATCTACCCTCATATTACAA
GTAATATATCCTATTATCTCAGGAGAGGAC
TTAACTCTTATATTCTCGAATTAGCGACTGCTCAAATGGTCTGCACTACCTGCACGCAACCATCAGCTATGCTCAACGTTGCTTGGACCTCACAAGGACTTCGTAAACTTGGTGTATTGG
ACGACCTCGGGGATCCCTACTTCGCCATGGGGCAATTAAACGACGCTGCAGCCCTTGGCGATACCGATCCAAGCACAACGTGGGCCCCAGGTCTTTATGCGAACAAGACGGACGGTGCTT
TCCTGATTGCGGCTAGAGATTGGGAACCTATCGATACCTTACTGAATCAAATGAAGAATTGGTTGGGCGATGCGATCGTAGAAACGCACAGCAACAGGGGCGCGGTACGACCCGGCGATG
CAGCTGGTAAAGAACACTTTGGTTGGCTTGATGGCTTT
GTAAGTGACTCCTTTCCAAGTTGAAGGAAATTTTGCGGCTCACCCATCGTCTTTGTGACAGATTCAACCCGCAGTCGCTGGT
TTTGCTACGAGCACCTACCCCGGACAACAGCTTCTCCTACCTGGCACGCTTCTGACGAAAGAAATTGGCGACCCCCGCAGAGCTGCCCGACCAGCATGGACGAAATGGGGCTCCTTCATG
GCATACCGACAACTCCAAGAGCTCGTTCCTGAGTTCGATGACTACCTCATGCAAGA
GTTCGTCGCCCAATCACACTTTCGTTTCAATGTTGTATTGATCACACCCCAGAGCTGCTCTAAT
CCAAGACTCGTCGAGGAGCGTTCGCGAGCGTGCTGATCTTCTTGGCGCTCGTATGTTCGGTCGCTGGAAGAGC
GTCAGTTGTTATTTCGCATTCTATGCGCCATATTTGCTCATCCACGA
AACTAGGGTACTCCTCTTGACCTTGCCCCAGAGAGGGACGATCCCTCCATTGGCCCGAATCTTATGCTCAACAACAACTTCGACTTCAATCACCCTGCGCCCTTCGATATCAACAGTAAC
CAGTCCTATTGTCCCTTCTCCGCACACATCCGCAAGATTCGTCCCCGCGCTGACCAGGGAAACACAAACCTCAAGAACCAAATGATTAGGGCAAGTATACCCTATGGCGAAGAGC
GTAAG
TAGTTTCATCCGCGTCGTTTCTTGGCTGTAGCTCATGTTCCTTCAGTCAGCGACGATGAGATCAACAGCAAGAAAACAGCGACTGAACGTGGTGTGGCGTTCGGTAGGCCCCCTACCTAT
ATTTGCTAGATTCCGTTCTCACGCATCTATACCAATTCTAGTGACATATCAGAGTGATCTCGGTTCCGGGTTCCACTTCCAACAAGCCGAGTGGGCTAACAACGTCAAGTCAGTCACAAT
CTATACCCATCGCTGCTGAACCCATCTCATCCCTCAACCTAGCATTCCCACCGGTAAAAGCGACCCAACGCCTGGATTTGACCCAATTGTCGGCCAGAACAACGGCAAACCGCTTGTTGT
GTCTGGAATCGACTACACAGACCTCAATCACGACTTGACTTTCATGAGCTTCGTTGTGTCTAAGGGAGGTGACTACTTCTTCAGCCCCTCCATGTCCGCCATCTTGCACAAAATCGCTGC
TTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGTGGACTACCTGCGTCGCTCTCACTTCGTTAGTACCTTACACCCTCCTGCCCAGTTATGGGTTCAGTCTGCCCCAGCAGCTCGAGGCGAGGCAGAACGACTATCCGAGTGGA
TCACTGTTACACG
ATTATCCTGGGCAACATACATTGCCAACGCTTGAGTTGATCCAGAAATTGAATGCCACTAATGGCACATTCCTTCCGCTGGAGGAGATTCAAGGAGACATCATGATT
GGGATGAGGAAGCCGAAGGAAATATTCTTTTTCTACTCGATTCAGAACCCAAGAAAGTTCAAGAGTGTCCTCGCGAAACTGATCTACCCTCATATTACAA
CGACTGCTCAAATGGTCTGC
ACTACCTGCACGCAACCATCAGCTATGCTCAACGTTGCTTGGACCTCACAAGGACTTCGTAAACTTGGTGTATTGGACGACCTCGGGGATCCCTACTTCGCCATGGGGCAATTAAACGAC
GCTGCAGCCCTTGGCGATACCGATCCAAGCACAACGTGGGCCCCAGGTCTTTATGCGAACAAGACGGACGGTGCTTTCCTGATTGCGGCTAGAGATTGGGAACCTATCGATACCTTACTG
AATCAAATGAAGAATTGGTTGGGCGATGCGATCGTAGAAACGCACAGCAACAGGGGCGCGGTACGACCCGGCGATGCAGCTGGTAAAGAACACTTTGGTTGGCTTGATGGCTTT
ATTCAA
CCCGCAGTCGCTGGTTTTGCTACGAGCACCTACCCCGGACAACAGCTTCTCCTACCTGGCACGCTTCTGACGAAAGAAATTGGCGACCCCCGCAGAGCTGCCCGACCAGCATGGACGAAA
TGGGGCTCCTTCATGGCATACCGACAACTCCAAGAGCTCGTTCCTGAGTTCGATGACTACCTCATGCAAGA
AGCTGCTCTAATCCAAGACTCGTCGAGGAGCGTTCGCGAGCGTGCTGAT
CTTCTTGGCGCTCGTATGTTCGGTCGCTGGAAGAGC
GGTACTCCTCTTGACCTTGCCCCAGAGAGGGACGATCCCTCCATTGGCCCGAATCTTATGCTCAACAACAACTTCGACTTCAAT
CACCCTGCGCCCTTCGATATCAACAGTAACCAGTCCTATTGTCCCTTCTCCGCACACATCCGCAAGATTCGTCCCCGCGCTGACCAGGGAAACACAAACCTCAAGAACCAAATGATTAGG
GCAAGTATACCCTATGGCGAAGAGC
TCAGCGACGATGAGATCAACAGCAAGAAAACAGCGACTGAACGTGGTGTGGCGTTCGTGACATATCAGAGTGATCTCGGTTCCGGGTTCCACTTC
CAACAAGCCGAGTGGGCTAACAACGTCAA
CATTCCCACCGGTAAAAGCGACCCAACGCCTGGATTTGACCCAATTGTCGGCCAGAACAACGGCAAACCGCTTGTTGTGTCTGGAATCGAC
TACACAGACCTCAATCACGACTTGACTTTCATGAGCTTCGTTGTGTCTAAGGGAGGTGACTACTTCTTCAGCCCCTCCATGTCCGCCATCTTGCACAAAATCGCTGCTTAA

Retrieve as FASTA