Entry information : MtAPx07-A ( Medtr3g088160.2[4.0] / Medtr3g100720.1[3.5] / MtAPx07-a)
Entry ID 5135
Creation 2007-04-06 (Christophe Dunand)
Last sequence changes 2016-04-07 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: MtAPx07-A ( Medtr3g088160.2[4.0] / Medtr3g100720.1[3.5] / MtAPx07-a)
Name (synonym) MtAPx07-A ( Medtr3g088160.2[4.0] / Medtr3g100720.1[3.5] / MtAPx07-a)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation Thylakoid-bound
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtAPx07-A
start..stop
S start..stop
MtAPx07-B 796 0 1..387 1..387
GmAPx07 654 0 1..386 1..382
GmAPx08 634 0 61..387 36..366
RrAPx01 622 0 63..387 35..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39980002..39980232 231 N° 2 39980317..39980448 132 N° 3 39982042..39982162 121 N° 4 39982236..39982336 101
N° 5 39982425..39982512 88 N° 6 39982929..39982996 68 N° 7 39983087..39983173 87 N° 8 39985113..39985187 75
N° 9 39985327..39985404 78 N° 10 39985497..39985601 105 N° 11 39985805..39985876 72 N° 12 39986024..39986029 6
join(39980002..39980232,39980317..39980448,39982042..39982162,39982236..39982336 ,39982425..39982512,39982929..39982996,39983087..39983173,39985113..39985187,399 85327..39985404,39985497..39985601,39985805..39985876,39986024..39986029)


exon

Literature and cross-references MtAPx07-A ( Medtr3g088160.2[4.0] / Medtr3g100720.1[3.5] / MtAPx07-a)
Protein ref. UniProtKB:   G7J4Y3
DNA ref. Phytozome 11:   chr3 (39980002..39986029)
Cluster/Prediction ref. Phytozome Gene 11:   31057726 UniGene:   Mtr.6518
Protein sequence: MtAPx07-A ( Medtr3g088160.2[4.0] / Medtr3g100720.1[3.5] / MtAPx07-a)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   388
PWM (Da):   %s   42058.43  
PI (pH):   %s   9.16
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MADRVLLTPSLSSSPTTMATITGGAAARMIPSATRATVSLSTSRSFFSFSLASSSRSVSSLNCLRSSPRISHIFLNQRRGEVRVSSGRFGTVAFASDPDQLKSAREDIKELLKTKFCHPLLIRLGWHDAGTYNKNIEEWPQRGGANGSLRFEVELKHGANAGLVNALKLLQPIKDKYSGVTYADLFQLASATAVEAGGPKIPMKYGRVDVTGPEQCPEEGRLPDAGPPSPADHLRQVFYRMGLNDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTAQWLKFDNSYFKDIKEKKDEDLLVLPTDAALFDDPSFKVYAEKYAVDQEAFFKDYAEAHAKLSNLGAKFEPAEGVVVDGSPNVVGEKFVAAKYSSGKE*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 55 ESTs. Possible splicing variant MtAPx07-b. UniGene Mtr.6518 also contains ESTs from the MtAPx07-b, however they cannot be distinguished (except for 3 ESTs, see Remarks in MtAPx07-b).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACCGTGTGTTACTCACTCCTTCACTCTCTTCTTCACCAACCACAATGGCTACTATCACCGGCGGCGCCGCCGCACGCATGATTCCCTCCGCCACTAGAGCCACCGTCTCACTT
TCAACTTCCCGTTCGTTCTTCTCATTTTCATTGGCATCTTCTTCCCGTTCCGTTTCCTCGCTCAATTGCTTGCGTTCTTCTCCTCGCATTTCTCACATCTTTCTCAATCAG
GTTTCGTTT
CGCTATTTCTCGTTGATGATTTTTTTTAGCATTTTTTTTAGTTCGTTTGTATTAATTCCGTTTGCGATTTTTCAGCGAAGAGGAGAAGTTCGCGTTTCGAGTGGACGATTCGGAACGGTT
GCCTTTGCGTCTGATCCTGATCAGTTGAAGAGCGCTAGAGAAGATATCAAGGAGCTTCTTAAGACTAAGTTCTGTCATCCTCTTTTG
GTAATTTTCAGTGCTTTTTTTCTTGGATTTTGT
TTAATTTTTTATGATTTTTCTGTGCATTGCATTTGATTTAGCGTTTTCTTTGTCTGGAATTGAAGTTGTATAACGTAAGCTTCAATAATTGATTTTTCTGTAATTTTATGGTGACTGAAC
AGCTTTATAACAGCTTATTTGCAGCTTATAGGACAAACACTTATCATGATAAGCACTTATGTATAAGTTTGCATTAGCTTTTTTTATAGCAGAACATACAATAACGTTAAATTGTTTTTG
AACATGCTATAAGTTGTTTTTATAAGCTATATTGGAGAACTTATGAAAATAAGTTGAAAAAAGCTTATGAAACCAGTCATAAGCTGTTTTCATAAGTTCTCTTAAACAGTCTCACAAAAC
TTATGCTAGTAGATAAGCTCAAACAAGCCAATCCAAACAGACCCTAATCCTCTTGATATCCAAGGTGAAAATAAGTCAAGAGTATATTTGGTTTCATTTTTGGAGCTGCCAATTTATTTT
AGAGACGTAGAATCAATTTAACAATGTTTGGGTGTTTTTTGGTAGGATTGATTTTGCCTGAATTAATTCTAACTGGAAGCTAGGGTCTTTAGTTTTTGTTTCTAAACATGATTTTTACTC
TTAACTTATATTGTTCAACAACTCAGATTTACAAATATGTATCCAAACATAAACCACTTCCATTTAACTCACTTTTAACTAAAATCAATTCATTCTGAATCAATTTTTTGTCACGTCATT
GCAGAACCAAACACACATTAAGTAACTAAGTTCCTTGGTCAGTGACTCATATTATTAGGGGCTTGCATTCTCTATTATTTTATATTCTCGTTTTTTATTAACTTTCTTCTTCAAATTGAT
ATGTGAAGTCATACATATATTTTTCAATGTTATGGTTCTTATTTCAAGATTAGGAGTTTTTTCTATAATTCTATTGTTGAATTTCCGGTTTTAGTGTTCCATTAACAGTGTCTTTGCTGG
TCGTTGTTTGATGATTGATACAAAAATGTTTACGATACACTATAAATTGTCGGGCGAATCTCTCCTACAAAGACTAGTGCAAAGCACTTGTGCAACATGTGTATGCAGTGTCCTGATTAT
ACCTCTACTATATCTTTCTACTTAAAACTCACTTAAAAAGAGAAAACAAACTAAAGCATCAGCTAATTGGCCAACATGATATTGTGGCATAGAATAGAATCTCTGTAGCACTGACACCTC
TGTTCGAAGGCGTGCCGGTGTCCGAAACCGACACATGTGCTTACATTAAATTAATTAATTTTTTTTCAAATTAACAAAGGTGTCGACTTGTCGGTGTCAGTGTCGATGCTTCAAAGAATA
GAGTACTCTTTGCATCACATTTACCGTAAGAGATTTATAGCTTTACAGTGCGAAATGATTCAAAGATGATGAATAAACTTTACTGCGACTAAAATGATTCAGTCAGCCTAGTTATCAAAC
TCTGAGTTGATGAGATATACCAGCCACATATAGATGGAACTTTGTCATATGATTTGTAGCATAGGTGTGAACTCTATTTTCTTTTCATTGTGATGGTTCACACATACTTTTATGTTACAG

ATTCGTTTGGGATGGCATGATGCTGGTACTTATAATAAGAATATTGAGGAGTGGCCACAGAGAGGTGGAGCCAATGGTAGCTTAAGATTTGAAGTTGAGTTGAAACATGGAGCCAATGCT
G
GTATGTATTCATTAACCACCAGTTGTATCTGAATATTGCTCGTGGTAATTATTCCTATGAGCTGCAATTTCAGGCCTTGTAAATGCATTGAAACTTCTCCAGCCAATCAAAGACAAATA
TTCAGGCGTGACATATGCAGACTTATTTCAGTTAGCTAGTGCTACAGCTGTGGAG
GTTGTCTAAGTCCTACTTTGACTTCAAGATTGATTGTTGTCTATTTGAAATAATTAAATGATACT
GACCGTTTTCTTTGAATCTTCAGGAAGCTGGAGGCCCAAAAATTCCCATGAAATATGGAAGAGTTGACGTCACTGGACCTGAACAATGCCCTGAAGAAGGGAGACTTCCTGGTAAAACCC
ATATATCTAATTGAAGTAATATTGTGATTTAAACTTTCTTCTTTGCCTCTAGGATTCTAGGACATGGATTGGATAAGCTACTGTTAATTTGGGAATATGAAACAGAGAGACAATAAGTTT
TTTATTAGGCATCTATTAACTAACAGTTGGCCATATAGAAATGGCTGTGCTCGCATATTTAACTTCTATCGTTACATTCTGTTATATCACGCTTTTATAACTGATGATATGATGTCTTTG
TTGGTTTTGGTTCGGTTTTGTATATGATTTTCCAATGTAAACAAACAATTTGGACAGGTTTAATTTGGTCGTTTAGATTTCTGGGTTGTTAACACTTAACAGCCCTAGTTACTAGTTTTT
TCGGTTGCTAACTACTTTTATTTTTATTTTTTTATTTATGTATTTAGATGCTGGCCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTACCGAATGGGGTTGAATGACAAGGTAAT
TCCCTGTGTTTATTATAAGGCTGGGGGTAAGTATTGGACTGTAGCTTTATGTCTGATCTTGACTATCACGTTATTGTATCCGCAGGAAATTGTTGCATTATCTGGTGCGCACACACTGGG
GCGGTCTAGACCAGACCGCAGTGGCTGGGGCAAACCTGAGACTAAATACACG
GTATACTATCTGCCTTTTTACCCTCAAGCTATTAAACATGATTTTGAAAGAGTGCTGAACTATTGCAA
AACTACAGTCTAATTTTAATATTTGATGGTAAATAATCGTTTGAATGGATGGTTGTTTTATGTTAAATCTTTTTATACTGAATTGGATGATGACCACTGCTTTTTATAACTCATCTCCTT
TATAACACCTTCAAGTCATTTGGTTGAGCCTAGAATGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCTGGTTTTGTAGGGTTGAGTTAGACTTGAGCCAAATTTCAAGAGATATGAATA
CAATGAGTGTTTGTCGTTACTCCGTTTGTGTAGACATTCCGTGTCTTACATCAGTTTACTTTTAAGAAATGTAAACCTAAATCTTTGCTACGATTGTTTCTTTCTGTCTTTAATAGTTCT
TATGCCAACTATATATAATCTTAAGTATACAGACCTGTCAAGTTTTGTGCATCTCCAGAGCTAGTTTACATGATGATCAAATAGTTTTTGAATGGAATGATATCTGAAATCAATAAAACA
ATATAAGATTCATGTGTATTTTGATAGAAATCAACTGATATAGAAGAATAAAATAGGGAAAATCCCTTTGATTACAGAATAATATTGCAGAACTTCGAGGGTCTGCACCTCCCTATTGCC
TAAATGGCCCCTTCCCAGTCAAATCCTCAGATGCCCCTCAATCTTCCCATCCCTCCCCTATTTATTCTTAAAACTTAACCTCCCACTACTGACTTAATTAATTATTAATCATAATATAAT
AATAAACCATAACTGCAAAATTAACTACTATAATTATAATAAAACTGACACAATTCTAATAAGATATCCAACAATACTCCCCCCCTAAAGATTCACCTTGTCCTCAAGGTGAAGGATATC
ATAAGTGTCCACCTGGGTCCCATAACTTGAAGTATAATGACAGAGCACTGTGTGAATCATGCAAACTTATGCCTTGATCATATACCCTGTTTGTGGTGATATTTTTTAGCAAAAAATACA
GGATGATTGATGTCGTGGTGCCCACAGTAGTTCCCCTTATCTCTGACCCCATACTCATTTCTTTATTGCAAAGAAGTTTGCACAAATCTGTTTTGCTCTCCTGTCCCATTTCCACAATCA
TGACATGCATATGGACATTTTCTACATCTCTCTCTATTTTCCCCATTTCTACATCTTCCCAACCTTTCTCTTCTCCTATCGCGGTGGGATTTGGATTGCCCTGGTCAATATCTTGTGGTT
GAATATTGAATGAACCTTGAGTCGTCAACCACTCCAATTCAGTTTCAGGTTCCTCTTCTTCATCAGACATAGGCATGATATCCCGATATTCCGGTTTAAAACGCCAAATAAATGCAAGTA
AGAACATATGCCAACTAACCTGTTGATGGCGTCGATTCCACCAGTGTGACCATTGGCGAGCACGACCTCTGAGTAACATCAACGCATCTGTCAGCTTCTCCTCATCTGGTGTATCTCTCT
TTTTGAAATGTTCCTCAATGCATAGCAGCCACCAGTATGCATCTTCTTTGCCATCAAACACTCGAAACTCCATTTCTTCCATAACGGTACAGCGGTTCCAAGATCGATGCTCTGATACCA
GTTGATAGAAATCAACTGATATAGAAGAATAAAATAGGGAAAATCCCTTTGATTACAGAATAATATTGCAGAACTTCGAGGGTCTGCACCTCCCTATTGCCAAAATGGCCCCTTCCCAGT
CAAATCCTCAGATGCCCCTCAATCTTCCCATCCCTCCCCTATTTATTCTTAAAACTTAACCTCCCACTACTGACTTAATTAATTATTAATCATAATATAATAATAAACCATAACTGCATA
ATTAACTACTATAATTATAATAAAACTGACACAATTCTAATAAGATATCCAACATATTTCTCATTCTACAGAAAGATGGGCCAGGAGCACCTGGGGGACAATCCTGGACTGCACAATGGT
TAAAGTTTGACAACTCTTACTTCAAG
GTCAGATATTTTTAATTTATTTTTTGATTATTTTGTTGGGAGGGGAGGGGGTGATTGTATAACAGTATAGGAAGAAGGGAAGAGGAGAGGGGAG
TATGCATAGTCTACTTTTTCTTTTTGTAATTATTGTTACATACAGGACATCAAAGAAAAAAAGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTTTTTGACGATCCTTCCTTC
AAG
GTAAAGTTGCTGAATTTTTTTCCCATGTCCATTTTAATTCAACATAAAATTAAACTGTGATATACCCATAAAATTATTTGTGAAATATGCAGGTATATGCTGAGAAATATGCTGTAG
ATCAGGAAGCATTCTTTAAAGATTATGCTGAAGCACATGCCAAACTCAGCAACCTTGGAGCAAAGTTTGAACCTGCAGAG
GTCTGTTCACGTTGAGCTACTGTTTTGTGCATTTTGAGAT
GGGTGTGCTTATTATGTGATTACTGACCTAGATATTATGTTCTTTCATACAAAATTTATTACCTTTTCTTTTTCATGTCTGCATACATATTTGATTTGAGTTCAAATAACAAGACAGTTG
ACCAAATCACCTATTAAAGTTTTCTTTGTTATCTGTTTTTCAGGGCGTTGTGGTAGATGGTTCTCCAAATGTAGTGGGAGAGAAGTTTGTAGCAGCCAAGTACTCCTCTGGAAAGGTTTT
AAGCTTGCACGATTTATTAAATTTTACTATTCATTTTCTTGATGCTTGTCGGAAATTTATTATATATAATTTAATGAAAGGTTTGCATAGAATACATATTTTGCATATTGTTCATTGTTT
CTATATTCCTGGTTTGATGCAGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACCGTGTGTTACTCACTCCTTCACTCTCTTCTTCACCAACCACAATGGCTACTATCACCGGCGGCGCCGCCGCACGCATGATTCCCTCCGCCACTAGAGCCACCGTCTCACTT
TCAACTTCCCGTTCGTTCTTCTCATTTTCATTGGCATCTTCTTCCCGTTCCGTTTCCTCGCTCAATTGCTTGCGTTCTTCTCCTCGCATTTCTCACATCTTTCTCAATCAG
CGAAGAGGA
GAAGTTCGCGTTTCGAGTGGACGATTCGGAACGGTTGCCTTTGCGTCTGATCCTGATCAGTTGAAGAGCGCTAGAGAAGATATCAAGGAGCTTCTTAAGACTAAGTTCTGTCATCCTCTT
TTG
ATTCGTTTGGGATGGCATGATGCTGGTACTTATAATAAGAATATTGAGGAGTGGCCACAGAGAGGTGGAGCCAATGGTAGCTTAAGATTTGAAGTTGAGTTGAAACATGGAGCCAAT
GCTG
GCCTTGTAAATGCATTGAAACTTCTCCAGCCAATCAAAGACAAATATTCAGGCGTGACATATGCAGACTTATTTCAGTTAGCTAGTGCTACAGCTGTGGAGGAAGCTGGAGGCCCA
AAAATTCCCATGAAATATGGAAGAGTTGACGTCACTGGACCTGAACAATGCCCTGAAGAAGGGAGACTTCCTG
ATGCTGGCCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTAC
CGAATGGGGTTGAATGACAAG
GAAATTGTTGCATTATCTGGTGCGCACACACTGGGGCGGTCTAGACCAGACCGCAGTGGCTGGGGCAAACCTGAGACTAAATACACGAAAGATGGGCCA
GGAGCACCTGGGGGACAATCCTGGACTGCACAATGGTTAAAGTTTGACAACTCTTACTTCAAG
GACATCAAAGAAAAAAAGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTT
TTTGACGATCCTTCCTTCAAG
GTATATGCTGAGAAATATGCTGTAGATCAGGAAGCATTCTTTAAAGATTATGCTGAAGCACATGCCAAACTCAGCAACCTTGGAGCAAAGTTTGAACCT
GCAGAG
GGCGTTGTGGTAGATGGTTCTCCAAATGTAGTGGGAGAGAAGTTTGTAGCAGCCAAGTACTCCTCTGGAAAGGAGTAA

Retrieve as FASTA