Entry information : MtAPx07-B ( Medtr3g088160.1[4.0] / MtAPx07-b)
Entry ID 5136
Creation 2007-04-06 (Christophe Dunand)
Last sequence changes 2016-04-07 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: MtAPx07-B ( Medtr3g088160.1[4.0] / MtAPx07-b)
Name (synonym) MtAPx07-B ( Medtr3g088160.1[4.0] / MtAPx07-b)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation Thylakoid-bound
Tissue type Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtAPx07-B
start..stop
S start..stop
MtAPx07-A 796 0 1..387 1..387
GmAPx07 733 0 1..436 1..432
VuAPx03-2 693 0 18..436 1..412
LeAPx08 665 0 18..436 1..421
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39980002..39980232 231 N° 2 39980317..39980448 132 N° 3 39982042..39982162 121 N° 4 39982236..39982336 101
N° 5 39982425..39982512 88 N° 6 39982929..39982996 68 N° 7 39983087..39983173 87 N° 8 39985113..39985187 75
N° 9 39985327..39985404 78 N° 10 39985497..39985601 105 N° 11 39985805..39985876 72 N° 12 39986182..39986334 153
join(39980002..39980232,39980317..39980448,39982042..39982162,39982236..39982336 ,39982425..39982512,39982929..39982996,39983087..39983173,39985113..39985187,399 85327..39985404,39985497..39985601,39985805..39985876,39986182..39986334)


exon

Literature and cross-references MtAPx07-B ( Medtr3g088160.1[4.0] / MtAPx07-b)
Literature Maunoury,N., Redondo-Nieto,M., Vaubert,D., Horvath,G., Mergaert,P. and Kondorosi,E. Expressed sequence tags from Medicago truncatula R108 young nodule library
Protein ref. UniProtKB:   G7J4Y2
DNA ref. Phytozome 11:   chr3 (39980002..39986334)
Cluster/Prediction ref. Phytozome Gene 11:   31057725 UniGene:   Mtr.6518
Protein sequence: MtAPx07-B ( Medtr3g088160.1[4.0] / MtAPx07-b)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   437
PWM (Da):   %s   47438.4 Transmb domain:   %s   o416-435i
PI (pH):   %s   9.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MADRVLLTPSLSSSPTTMATITGGAAARMIPSATRATVSLSTSRSFFSFSLASSSRSVSSLNCLRSSPRISHIFLNQRRGEVRVSSGRFGTVAFASDPDQLKSAREDIKELLKTKFCHPLLIRLGWHDAGTYNKNIEEWPQRGGANGSLRFEVELKHGANAGLVNALKLLQPIKDKYSGVTYADLFQLASATAVEAGGPKIPMKYGRVDVTGPEQCPEEGRLPDAGPPSPADHLRQVFYRMGLNDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGAPGGQSWTAQWLKFDNSYFKDIKEKKDEDLLVLPTDAALFDDPSFKVYAEKYAVDQEAFFKDYAEAHAKLSNLGAKFEPAEGVVVDGSPNVVGEKFVAAKYSSGKKELSDAMRKKIRAEYEAVGGSPDKALKSNYFLNIIIVIAALAILTYLFGN*

Retrieve as FASTA  
Remarks Complete sequence from at least 4 ESTs. Splicing variant of MtAPx07-a. The absence of sequence between SGK and ELSD is confirmed with the ESTs DY617089, BG455730 and BG457350. 3 ESTs out of 4 (all ESTs from TIGR TC accession) are also included in UniGene Mtr.6518. However it is impossible to distinguish which one belongs to each splicing variant.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACCGTGTGTTACTCACTCCTTCACTCTCTTCTTCACCAACCACAATGGCTACTATCACCGGCGGCGCCGCCGCACGCATGATTCCCTCCGCCACTAGAGCCACCGTCTCACTT
TCAACTTCCCGTTCGTTCTTCTCATTTTCATTGGCATCTTCTTCCCGTTCCGTTTCCTCGCTCAATTGCTTGCGTTCTTCTCCTCGCATTTCTCACATCTTTCTCAATCAG
GTTTCGTTT
CGCTATTTCTCGTTGATGATTTTTTTTAGCATTTTTTTTAGTTCGTTTGTATTAATTCCGTTTGCGATTTTTCAGCGAAGAGGAGAAGTTCGCGTTTCGAGTGGACGATTCGGAACGGTT
GCCTTTGCGTCTGATCCTGATCAGTTGAAGAGCGCTAGAGAAGATATCAAGGAGCTTCTTAAGACTAAGTTCTGTCATCCTCTTTTG
GTAATTTTCAGTGCTTTTTTTCTTGGATTTTGT
TTAATTTTTTATGATTTTTCTGTGCATTGCATTTGATTTAGCGTTTTCTTTGTCTGGAATTGAAGTTGTATAACGTAAGCTTCAATAATTGATTTTTCTGTAATTTTATGGTGACTGAAC
AGCTTTATAACAGCTTATTTGCAGCTTATAGGACAAACACTTATCATGATAAGCACTTATGTATAAGTTTGCATTAGCTTTTTTTATAGCAGAACATACAATAACGTTAAATTGTTTTTG
AACATGCTATAAGTTGTTTTTATAAGCTATATTGGAGAACTTATGAAAATAAGTTGAAAAAAGCTTATGAAACCAGTCATAAGCTGTTTTCATAAGTTCTCTTAAACAGTCTCACAAAAC
TTATGCTAGTAGATAAGCTCAAACAAGCCAATCCAAACAGACCCTAATCCTCTTGATATCCAAGGTGAAAATAAGTCAAGAGTATATTTGGTTTCATTTTTGGAGCTGCCAATTTATTTT
AGAGACGTAGAATCAATTTAACAATGTTTGGGTGTTTTTTGGTAGGATTGATTTTGCCTGAATTAATTCTAACTGGAAGCTAGGGTCTTTAGTTTTTGTTTCTAAACATGATTTTTACTC
TTAACTTATATTGTTCAACAACTCAGATTTACAAATATGTATCCAAACATAAACCACTTCCATTTAACTCACTTTTAACTAAAATCAATTCATTCTGAATCAATTTTTTGTCACGTCATT
GCAGAACCAAACACACATTAAGTAACTAAGTTCCTTGGTCAGTGACTCATATTATTAGGGGCTTGCATTCTCTATTATTTTATATTCTCGTTTTTTATTAACTTTCTTCTTCAAATTGAT
ATGTGAAGTCATACATATATTTTTCAATGTTATGGTTCTTATTTCAAGATTAGGAGTTTTTTCTATAATTCTATTGTTGAATTTCCGGTTTTAGTGTTCCATTAACAGTGTCTTTGCTGG
TCGTTGTTTGATGATTGATACAAAAATGTTTACGATACACTATAAATTGTCGGGCGAATCTCTCCTACAAAGACTAGTGCAAAGCACTTGTGCAACATGTGTATGCAGTGTCCTGATTAT
ACCTCTACTATATCTTTCTACTTAAAACTCACTTAAAAAGAGAAAACAAACTAAAGCATCAGCTAATTGGCCAACATGATATTGTGGCATAGAATAGAATCTCTGTAGCACTGACACCTC
TGTTCGAAGGCGTGCCGGTGTCCGAAACCGACACATGTGCTTACATTAAATTAATTAATTTTTTTTCAAATTAACAAAGGTGTCGACTTGTCGGTGTCAGTGTCGATGCTTCAAAGAATA
GAGTACTCTTTGCATCACATTTACCGTAAGAGATTTATAGCTTTACAGTGCGAAATGATTCAAAGATGATGAATAAACTTTACTGCGACTAAAATGATTCAGTCAGCCTAGTTATCAAAC
TCTGAGTTGATGAGATATACCAGCCACATATAGATGGAACTTTGTCATATGATTTGTAGCATAGGTGTGAACTCTATTTTCTTTTCATTGTGATGGTTCACACATACTTTTATGTTACAG

ATTCGTTTGGGATGGCATGATGCTGGTACTTATAATAAGAATATTGAGGAGTGGCCACAGAGAGGTGGAGCCAATGGTAGCTTAAGATTTGAAGTTGAGTTGAAACATGGAGCCAATGCT
G
GTATGTATTCATTAACCACCAGTTGTATCTGAATATTGCTCGTGGTAATTATTCCTATGAGCTGCAATTTCAGGCCTTGTAAATGCATTGAAACTTCTCCAGCCAATCAAAGACAAATA
TTCAGGCGTGACATATGCAGACTTATTTCAGTTAGCTAGTGCTACAGCTGTGGAG
GTTGTCTAAGTCCTACTTTGACTTCAAGATTGATTGTTGTCTATTTGAAATAATTAAATGATACT
GACCGTTTTCTTTGAATCTTCAGGAAGCTGGAGGCCCAAAAATTCCCATGAAATATGGAAGAGTTGACGTCACTGGACCTGAACAATGCCCTGAAGAAGGGAGACTTCCTGGTAAAACCC
ATATATCTAATTGAAGTAATATTGTGATTTAAACTTTCTTCTTTGCCTCTAGGATTCTAGGACATGGATTGGATAAGCTACTGTTAATTTGGGAATATGAAACAGAGAGACAATAAGTTT
TTTATTAGGCATCTATTAACTAACAGTTGGCCATATAGAAATGGCTGTGCTCGCATATTTAACTTCTATCGTTACATTCTGTTATATCACGCTTTTATAACTGATGATATGATGTCTTTG
TTGGTTTTGGTTCGGTTTTGTATATGATTTTCCAATGTAAACAAACAATTTGGACAGGTTTAATTTGGTCGTTTAGATTTCTGGGTTGTTAACACTTAACAGCCCTAGTTACTAGTTTTT
TCGGTTGCTAACTACTTTTATTTTTATTTTTTTATTTATGTATTTAGATGCTGGCCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTACCGAATGGGGTTGAATGACAAGGTAAT
TCCCTGTGTTTATTATAAGGCTGGGGGTAAGTATTGGACTGTAGCTTTATGTCTGATCTTGACTATCACGTTATTGTATCCGCAGGAAATTGTTGCATTATCTGGTGCGCACACACTGGG
GCGGTCTAGACCAGACCGCAGTGGCTGGGGCAAACCTGAGACTAAATACACG
GTATACTATCTGCCTTTTTACCCTCAAGCTATTAAACATGATTTTGAAAGAGTGCTGAACTATTGCAA
AACTACAGTCTAATTTTAATATTTGATGGTAAATAATCGTTTGAATGGATGGTTGTTTTATGTTAAATCTTTTTATACTGAATTGGATGATGACCACTGCTTTTTATAACTCATCTCCTT
TATAACACCTTCAAGTCATTTGGTTGAGCCTAGAATGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCTGGTTTTGTAGGGTTGAGTTAGACTTGAGCCAAATTTCAAGAGATATGAATA
CAATGAGTGTTTGTCGTTACTCCGTTTGTGTAGACATTCCGTGTCTTACATCAGTTTACTTTTAAGAAATGTAAACCTAAATCTTTGCTACGATTGTTTCTTTCTGTCTTTAATAGTTCT
TATGCCAACTATATATAATCTTAAGTATACAGACCTGTCAAGTTTTGTGCATCTCCAGAGCTAGTTTACATGATGATCAAATAGTTTTTGAATGGAATGATATCTGAAATCAATAAAACA
ATATAAGATTCATGTGTATTTTGATAGAAATCAACTGATATAGAAGAATAAAATAGGGAAAATCCCTTTGATTACAGAATAATATTGCAGAACTTCGAGGGTCTGCACCTCCCTATTGCC
TAAATGGCCCCTTCCCAGTCAAATCCTCAGATGCCCCTCAATCTTCCCATCCCTCCCCTATTTATTCTTAAAACTTAACCTCCCACTACTGACTTAATTAATTATTAATCATAATATAAT
AATAAACCATAACTGCAAAATTAACTACTATAATTATAATAAAACTGACACAATTCTAATAAGATATCCAACAATACTCCCCCCCTAAAGATTCACCTTGTCCTCAAGGTGAAGGATATC
ATAAGTGTCCACCTGGGTCCCATAACTTGAAGTATAATGACAGAGCACTGTGTGAATCATGCAAACTTATGCCTTGATCATATACCCTGTTTGTGGTGATATTTTTTAGCAAAAAATACA
GGATGATTGATGTCGTGGTGCCCACAGTAGTTCCCCTTATCTCTGACCCCATACTCATTTCTTTATTGCAAAGAAGTTTGCACAAATCTGTTTTGCTCTCCTGTCCCATTTCCACAATCA
TGACATGCATATGGACATTTTCTACATCTCTCTCTATTTTCCCCATTTCTACATCTTCCCAACCTTTCTCTTCTCCTATCGCGGTGGGATTTGGATTGCCCTGGTCAATATCTTGTGGTT
GAATATTGAATGAACCTTGAGTCGTCAACCACTCCAATTCAGTTTCAGGTTCCTCTTCTTCATCAGACATAGGCATGATATCCCGATATTCCGGTTTAAAACGCCAAATAAATGCAAGTA
AGAACATATGCCAACTAACCTGTTGATGGCGTCGATTCCACCAGTGTGACCATTGGCGAGCACGACCTCTGAGTAACATCAACGCATCTGTCAGCTTCTCCTCATCTGGTGTATCTCTCT
TTTTGAAATGTTCCTCAATGCATAGCAGCCACCAGTATGCATCTTCTTTGCCATCAAACACTCGAAACTCCATTTCTTCCATAACGGTACAGCGGTTCCAAGATCGATGCTCTGATACCA
GTTGATAGAAATCAACTGATATAGAAGAATAAAATAGGGAAAATCCCTTTGATTACAGAATAATATTGCAGAACTTCGAGGGTCTGCACCTCCCTATTGCCAAAATGGCCCCTTCCCAGT
CAAATCCTCAGATGCCCCTCAATCTTCCCATCCCTCCCCTATTTATTCTTAAAACTTAACCTCCCACTACTGACTTAATTAATTATTAATCATAATATAATAATAAACCATAACTGCATA
ATTAACTACTATAATTATAATAAAACTGACACAATTCTAATAAGATATCCAACATATTTCTCATTCTACAGAAAGATGGGCCAGGAGCACCTGGGGGACAATCCTGGACTGCACAATGGT
TAAAGTTTGACAACTCTTACTTCAAG
GTCAGATATTTTTAATTTATTTTTTGATTATTTTGTTGGGAGGGGAGGGGGTGATTGTATAACAGTATAGGAAGAAGGGAAGAGGAGAGGGGAG
TATGCATAGTCTACTTTTTCTTTTTGTAATTATTGTTACATACAGGACATCAAAGAAAAAAAGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTTTTTGACGATCCTTCCTTC
AAG
GTAAAGTTGCTGAATTTTTTTCCCATGTCCATTTTAATTCAACATAAAATTAAACTGTGATATACCCATAAAATTATTTGTGAAATATGCAGGTATATGCTGAGAAATATGCTGTAG
ATCAGGAAGCATTCTTTAAAGATTATGCTGAAGCACATGCCAAACTCAGCAACCTTGGAGCAAAGTTTGAACCTGCAGAG
GTCTGTTCACGTTGAGCTACTGTTTTGTGCATTTTGAGAT
GGGTGTGCTTATTATGTGATTACTGACCTAGATATTATGTTCTTTCATACAAAATTTATTACCTTTTCTTTTTCATGTCTGCATACATATTTGATTTGAGTTCAAATAACAAGACAGTTG
ACCAAATCACCTATTAAAGTTTTCTTTGTTATCTGTTTTTCAGGGCGTTGTGGTAGATGGTTCTCCAAATGTAGTGGGAGAGAAGTTTGTAGCAGCCAAGTACTCCTCTGGAAAGGTTTT
AAGCTTGCACGATTTATTAAATTTTACTATTCATTTTCTTGATGCTTGTCGGAAATTTATTATATATAATTTAATGAAAGGTTTGCATAGAATACATATTTTGCATATTGTTCATTGTTT
CTATATTCCTGGTTTGATGCAGGAGTAAAAACAAGTGTGTTGTTTTCTTGTGCAAGTATCTTTAATAATACAAGAAGAAGCTATTTTCAAATCGTGGGATTATTATCACATGTAATTTTG
GAAATCTTAAAATGAAGAAGAAAGGAATAAAATTCAATAGTGTGCCTATTTGAATTGCAGAAAGAGCTGTCTGATGCTATGAGGAAGAAGATACGGGCTGAATATGAGGCTGTTGGCGGA
AGCCCAGATAAGGCTCTAAAGTCAAACTATTTCCTAAACATCATAATTGTTATTGCTGCTTTGGCTATTTTGACCTATCTGTTTGGAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGACCGTGTGTTACTCACTCCTTCACTCTCTTCTTCACCAACCACAATGGCTACTATCACCGGCGGCGCCGCCGCACGCATGATTCCCTCCGCCACTAGAGCCACCGTCTCACTT
TCAACTTCCCGTTCGTTCTTCTCATTTTCATTGGCATCTTCTTCCCGTTCCGTTTCCTCGCTCAATTGCTTGCGTTCTTCTCCTCGCATTTCTCACATCTTTCTCAATCAG
CGAAGAGGA
GAAGTTCGCGTTTCGAGTGGACGATTCGGAACGGTTGCCTTTGCGTCTGATCCTGATCAGTTGAAGAGCGCTAGAGAAGATATCAAGGAGCTTCTTAAGACTAAGTTCTGTCATCCTCTT
TTG
ATTCGTTTGGGATGGCATGATGCTGGTACTTATAATAAGAATATTGAGGAGTGGCCACAGAGAGGTGGAGCCAATGGTAGCTTAAGATTTGAAGTTGAGTTGAAACATGGAGCCAAT
GCTG
GCCTTGTAAATGCATTGAAACTTCTCCAGCCAATCAAAGACAAATATTCAGGCGTGACATATGCAGACTTATTTCAGTTAGCTAGTGCTACAGCTGTGGAGGAAGCTGGAGGCCCA
AAAATTCCCATGAAATATGGAAGAGTTGACGTCACTGGACCTGAACAATGCCCTGAAGAAGGGAGACTTCCTG
ATGCTGGCCCCCCTTCACCTGCTGATCATTTGCGTCAAGTTTTCTAC
CGAATGGGGTTGAATGACAAG
GAAATTGTTGCATTATCTGGTGCGCACACACTGGGGCGGTCTAGACCAGACCGCAGTGGCTGGGGCAAACCTGAGACTAAATACACGAAAGATGGGCCA
GGAGCACCTGGGGGACAATCCTGGACTGCACAATGGTTAAAGTTTGACAACTCTTACTTCAAG
GACATCAAAGAAAAAAAGGATGAAGATCTATTGGTATTGCCAACTGATGCTGCTCTT
TTTGACGATCCTTCCTTCAAG
GTATATGCTGAGAAATATGCTGTAGATCAGGAAGCATTCTTTAAAGATTATGCTGAAGCACATGCCAAACTCAGCAACCTTGGAGCAAAGTTTGAACCT
GCAGAG
GGCGTTGTGGTAGATGGTTCTCCAAATGTAGTGGGAGAGAAGTTTGTAGCAGCCAAGTACTCCTCTGGAAAGAAAGAGCTGTCTGATGCTATGAGGAAGAAGATACGGGCTGAA
TATGAGGCTGTTGGCGGAAGCCCAGATAAGGCTCTAAAGTCAAACTATTTCCTAAACATCATAATTGTTATTGCTGCTTTGGCTATTTTGACCTATCTGTTTGGAAACTAA

Retrieve as FASTA