Entry information : MtDiOx01 (Medtr6g007767.1[4.0])
Entry ID 5139
Creation 2007-04-06 (Christophe Dunand)
Last sequence changes 2016-04-06 (Catherine Mathe)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtDiOx01 (Medtr6g007767.1[4.0])
Name (synonym) MtDiOx01 (Medtr6g007767.1[4.0])
Class Alpha-dioxygenase    [Orthogroup: DiOx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtDiOx01
start..stop
S start..stop
PsDiOx01 1196 0 1..643 1..643
CclDiOx02 1046 0 9..643 4..639
VvDiOx02 1041 0 11..642 6..637
NatDiOx01 1038 0 3..642 2..641
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1936593..1936715 123 N° 2 1937119..1937382 264 N° 3 1938330..1938479 150 N° 4 1939857..1939990 134
N° 5 1940108..1940321 214 N° 6 1940417..1940562 146 N° 7 1940797..1941024 228 N° 8 1941186..1941388 203
N° 9 1941512..1941755 244 N° 10 1942082..1942307 226  
join(1936593..1936715,1937119..1937382,1938330..1938479,1939857..1939990,1940108 ..1940321,1940417..1940562,1940797..1941024,1941186..1941388,1941512..1941755,19 42082..1942307)


exon

Literature and cross-references MtDiOx01 (Medtr6g007767.1[4.0])
DNA ref. Phytozome 11:   chr6 (1936593..1942307)
Cluster/Prediction ref. Phytozome Gene 11:   31102859 UniGene:   Mtr.5411
Protein sequence: MtDiOx01 (Medtr6g007767.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   644
PWM (Da):   %s   73493.96  
PI (pH):   %s   7.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWSIITNPIKTIISNIIHHAIHKDFHAAVAKMSIIDAFLFLIVHSIDKLGIWHRLPVFLGLIYLAIRRHLHQEYNLINVGTTPVGVRSNPTDFPYRTADGRYNDPFNENAGSQGSFFGRNILPVDQKKKLLKPDPMVVATKLLERRTYKDTGKQFNVIAASWIQFMIHDWIDHMEDTQQIELIAPREVVNQCPLKSFKFFKTKEIPTGFYEVQTGHANIRTPWWDGSVIYGSNQEVLDKVRTFKDGKIKISKEGELLHNEDGTAISGDIRNSWAGVTTLQTLFVLEHNAVCDSLKEYPDLEDEDLYRYARLVTSAVIAKIHTIDWTVELLKTDTLLGGMRANWYGLLGKKFKDTFGHSGNSILSGFVGMKRAENHGVPYSLTEEFASVYRMHPLLPDFLHLRDTSASPGPNKSPPLIKEIPMNDLIGLQGEKTLIEIGVQKQLVSMGHQACGALELWNYPSWLRNLVPHNMDGTERSDHVDLAALIYRDRERGVARYNQFRRGLFMIPISKWEDLTDDKEVIKVLEEIYGDDVEELDVLVGLMAEKKIKGFAISETAFLIFLLMASRRLEGDRFFTSNYNEETYTEKGLKWVNTTETLKDVIDRHYPKMTNKWLNASSAFSVWDAPPNKHNPIPIYLRVPS

Retrieve as FASTA  
Remarks cDNA from 131 ESTs. Complete sequence from genomic (chromo 6, 9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTCTATAATAACGAATCCCATTAAAACCATCATTTCAAATATCATACACCATGCCATCCATAAAGATTTCCATGCAGCAGTGGCAAAAATGTCCATCATAGATGCTTTTCTCTTC
CTT
GTATAAATACTTTTCTTCATCATATCATATATATTGTTTTTGTTATTTTTCATAATTTAATCCTTGATAATTGGGAATATGGATCAAATTGTTATCGCATCAATGGTGTTTTTCTTT
ATAGAACCAGGTGGATAAGTCTATAAAACAAGGTGGATAAGCTGTTAAAACTGGAAAATAGTTATAACCTAGTTTATAGGGTTTGAATCAGGAAGAAGAAGAATAGAGAGAATTAAGTTA
TATTTAAAGTCTATTTACTAAAGTATTAAAATGTTTCATTTCATCTTGATAAAAAACTATTAACCAACTATACTAACAAATTACATATCTACTAATTTTTGTATAGTAATTTTTACTTTA
TTATGCTCATGAACCCTACTTACATTTTTTCTTATGGCATGTATAGATTGTACACTCCATTGACAAGTTGGGAATATGGCACCGTTTACCTGTTTTCTTAGGGCTAATATACTTGGCAAT
TAGGAGACATCTTCACCAAGAGTACAATCTCATCAATGTTGGAACAACACCTGTAGGGGTTAGGTCAAACCCTACTGATTTTCCATACAGAACTGCTGATGGAAGATATAATGATCCTTT
TAATGAAAATGCTGGAAGCCAAGGATCTTTCTTTGGCAGAAACATTCTCCCTGTTGATCAGAAGAAAAAG
GTACAAAATTGAAAGTTACACCATTGGCTATTTTAGACTTTTTTTATATT
ATTGACCTTTTCTTTTTTTGAGCAATTATTGACTATTTATAGTAAATAATATTAGTATGAGGTATATTCTCTTGTAAAAAATAATGTTAGTATATTATATTGGAAGTGGAGATCTAACAA
TTGACTATTGTTACTAACTCCCTCCCCTCACATAAGCTATCAAATAAACTTTATATCTGCCCCTTAAAATAAAGTAAACTATATATTATCTCTCTCCCAAAATATAAATATAAATTGGTC
GACAAAAATTTATATATTTGATTTAAAATTTATACTAAATTCATCAACTTATATTAATTCATTTTTGCTTACATTTTAGAACAAGAGTATCTATTTTTCAAACTTACCAATTAGAGATAT
AAATTTAGACATGTGTAAAAAAATTATATATAAAATTAGAGATGTGAGAAAATTGAAATTATAGTCATACACTTTTAATGCATATATAAGAATTAATTACATATGAATACAAGACAAGCA
GACAATAAACTGCACTATAATGCTTTTTTAGGAGTTGCTACAATTTTTTTTAGGAGGAAAGATGCTACAAATTTTGAAGATCATTTTAGTTTGTTCTATATAGCTTCTTTTAATAAACAT
TTTGTTCCTTAATTATCAAAGAAAGAAATTATAGAAGAATCTTATAATACTAATAAGATGTTTTAGGTAGCTAGTTAATGAACCTTTTTCGGTTAGCTCTTTTTTATTCCCTTGTTGAAT
ATAAAAGCACAAGATGTGCATGTGCATGAATGTAAAACAACACTAGAAACAAGAGCTGCCGAAACCGAATAAAAGGTTAGCTACACAAAAAACACTATGATGAGTACATAATTTTCAAAG
AATATATATAAATATTAATATTTTTGTTTGACCAAGAAAAATATTGTGTTTATGCAGTTGTTGAAACCAGACCCAATGGTGGTGGCAACAAAACTTCTAGAGAGGAGAACATATAAGGAC
ACAGGGAAGCAATTCAATGTGATTGCAGCATCTTGGATTCAATTTATGATACATGACTGGATAGATCATATGGAAGACACTCAGCAG
GTGCAAATGAATATTTTTTCTAAAAATAAATTG
AATAAACATTCATTTTTTCCTACTTGGTATTCATCGGTGTCACGACGATATTTATTAGATATTTTTTATAATATTACTATGTAGCCTGGTAAAGTAAATTCTGTTATTTCATCGATGAAT
ATGCCACATCATAAAAAACGATTTAAAAATTGACGGATATGTCACATCGTTAAAATGACTTAAAAATAAGATGAAAAAACTTGATTTTTATAGTGAAAAGACAAAATTTCTTTGTTTCAA
TCCCAAATACTAATAAAAACTAAATTAAATTAGATTCTCTTTGACAAAAATATCAAAATTTATCAATTTACTTGGTTAACCAAGAGTAGTTAATAAAGTCAACACATTATTTTTATCGCC
AATTATGTTTAGACATCCTTAAATTTCATACAGATATTTAACATTTTATTTTAGTTTAGTTTTTCTTTTCTTGTCGAATCATTAACATTTTTTTTAAGTATTATCACATCATTAACTCAT
CACCTTAAATTTTCTAATTTTTTTCCCTATAAAGATATTTACACCAAAAAGTCTCCACCTAACGTTATGCTAATTTCATATACTCATCATTTTAGGAATTATACTAGTTTCTCAGTTTTT
TCTAGAGAATACTACTAGTAGTGCCTTGAATTTTACACGTTACGTCTTTGGTTTTTTTTAATATATTTATGACGTTACATATCGAAAACATCATCATCATAAAATAATATAAGAGACGTA
ACAATGTAACACTACTAGAAAAAGCAAAATTAGCGAGGGAAATTAGTGACCGAAAAAATGAAATTCCTCACAAATTTTTTGGTCGCAAAATTTAATGACGGAATTAGAGAGGGATTTCAT
GTTTTCTCTCACTGAATATCCCTCACTAATTTTTGTTTTTTAGTAGTGTAACTCTATTTTTTTTAATGCTTACTCACGTGTTTTCTCCGATCTAGAATATAATTAAAAAAAAATAGCAAT
CAAAGTAGATGCATGTAGTTCAATTTTTTAACAAGATAGTACGTAAATCAACTTTGTATAACTTTTCTTTTTATCGGAACAAATACATATTAGCCACGTAAACACATATCCATGAATTAT
CTTGACCCCACAAATAAATTGCTCATTTTCATTGGTTTATAGGTAAATTATCCACCATTCTTCAAAGATAATTTAGAGGAAAAAAACCCGACAATAAAGTGTCAATTTAGTTTAGTGTTA
TATGGATGAAAAATCACGATTACGAATGACCTAAGTGTACTTATACAATTTATTAAACAATGTTTAAACTAAAATTTTATTGATAATGTTGTTGTTAATTTTCAAGAACATTTACAAATA
ATGTTTTATATTAATTACATACAGATTGAACTCATTGCACCAAGAGAAGTTGTAAACCAATGCCCACTTAAATCTTTCAAGTTCTTCAAGACAAAGGAAATCCCAACTGGCTTCTATGAG
GTCCAGACCGGACATGCAAACATCCGTACACCTTGGTG
GTAAGAATTTTTCTAAATCAGAGACAAAAACATATTTAATCCTAAATTATATAAATTTAAGACCTTTTAAATTGAACTTACA
CATGACATGACATGAATGAAACTATATGATAATAGGGATGGAAGTGTGATATATGGAAGCAATCAAGAAGTTTTGGACAAAGTGAGGACTTTCAAAGATGGTAAAATCAAAATATCAAAG
GAAGGTGAACTTCTTCATAATGAAGATGGAACAGCAATTTCAGGTGACATTCGTAATAGTTGGGCTGGTGTCACAACTTTGCAGACCCTTTTTGTTCTAGAACACAATGCTGTGTGTGAT
TCTCTTAAG
GTATATGCATATTATATACATTAAACAAATCTATAAAATGATATAATAAAATATAAAAAAACTAACATATATATTTGATAATTGTACTCTATTAGAAGGAATACCCAGACT
TGGAAGATGAAGATCTTTATCGCTATGCTAGACTGGTAACTTCAGCTGTGATAGCAAAGATTCACACCATAGATTGGACTGTGGAGCTTCTTAAAACTGACACTTTGCTTGGAGGCATGC
GCGCCAATTG
GTAAGAACACATGCAGTGATTTTCACTGTCGTTATTACTTCATATACGTCTCATTACGGGTCATTGCAAAACTATGTATTTAATATAAAATGCACAAGTTTTAATATTAA
CTTGTTAGTTTTGATTTCTTAATTTATGCAAGTTTGCACATGATAGAAAAACCTTTAGTTTTTTTTTTTTTTTATGTTGATTGCATTAATTTATGTCATGATACTAAAAGTTCAATTGTT
TTAGGTATGGATTACTGGGAAAGAAATTCAAGGACACATTTGGGCATTCCGGAAACTCCATATTGAGTGGATTTGTGGGCATGAAGAGAGCAGAAAATCATGGTGTTCCATACTCTTTAA
CTGAGGAATTTGCTAGTGTCTATAGAATGCATCCACTCCTGCCTGATTTCCTGCACTTGAGAGACACATCTGCCTCTCCTGGGCCTAACAAATCTCCGCCATTAATCAAAGA
GTATGACA
ATATATTATGATTTTTACATCATCATAACTATTACGCCCTCTGGTCTTAAAATATAAGAGAAGATTCTCTTTTCAAGTTCATTGAATAAATGATGTATTTAGTTCACATTATAATCTATA
AAAAAAGTCTCTCTTTTCTATGGTATTATATAGGATTCCTATGAACGATTTGATCGGACTACAAGGAGAGAAGACCTTGATAGAGATAGGAGTTCAAAAACAATTGGTATCAATGGGTCA
CCAAGCTTGTGGGGCCCTAGAACTTTGGAACTATCCATCATGGCTCAGAAACCTAGTACCACATAACATGGATGGCACAGAAAGATCTGATCATGTGGACTTAGCTGCTCTTGAAA
GTAT
GATATATGAACCTCACCTTTATTTTTAAGAATTTCATTTTTTTTTTTTTTTTGGGTTACATAGGCCATTTCTTATCTTATATTGAATTGACTTATAATGTGATCATATAAATGGTGCAGT
TTACAGGGATAGAGAGAGAGGTGTAGCAAGATATAACCAATTCAGGAGAGGACTATTCATGATACCTATTTCTAAATGGGAAGATTTAACAGATGATAAGGAAGTTATAAAAGTATTGGA
AGAGATATATGGTGATGATGTTGAGGAGCTTGATGTGCTTGTAGGTCTCATGGCAGAGAAGAAGATAAAGGGTTTTGCAATTAGTGAGACAGCTTTTTTAATCTTCCTTCTCATGGCATC
TAG
GTAAAATCGAACTAAATTTTTTATTTTATTTTATTGATGTCTATACCATTTACGAGGGGTAACCTTGGTGCAACTGGTAAAGTTGTTGTCATCTGACTGGAAGGTCGCGGATTGAAG
TCATGTAAACAACCTCTTGTGTAAAAAACAGGGTAAGGCTGCGTACAATACACCGAATGGTGGGACCCCATCCTGGATCTTGTGTATGCGGGAGTTTTTGTGCACCGTGTTGCCCTTTTT
TTATATATCTATACCTCTTTTATATCTAAATGTTTAGGGTTTAAGCTTTTATAAAATTGAATTTGATTGAACTTTAATGCACTTTGCAGGAGGCTAGAGGGTGATAGATTTTTCACAAGC
AACTACAATGAGGAGACATACACTGAAAAGGGTTTGAAATGGGTGAACACAACTGAAACCTTAAAGGATGTGATTGATCGTCACTACCCAAAAATGACAAACAAATGGTTGAATGCTTCA
AGTGCTTTCTCTGTTTGGGATGCACCACCAAACAAACACAACCCTATTCCAATTTACTTGCGTGTTCCTAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTCTATAATAACGAATCCCATTAAAACCATCATTTCAAATATCATACACCATGCCATCCATAAAGATTTCCATGCAGCAGTGGCAAAAATGTCCATCATAGATGCTTTTCTCTTC
CTT
ATTGTACACTCCATTGACAAGTTGGGAATATGGCACCGTTTACCTGTTTTCTTAGGGCTAATATACTTGGCAATTAGGAGACATCTTCACCAAGAGTACAATCTCATCAATGTTGGA
ACAACACCTGTAGGGGTTAGGTCAAACCCTACTGATTTTCCATACAGAACTGCTGATGGAAGATATAATGATCCTTTTAATGAAAATGCTGGAAGCCAAGGATCTTTCTTTGGCAGAAAC
ATTCTCCCTGTTGATCAGAAGAAAAAG
TTGTTGAAACCAGACCCAATGGTGGTGGCAACAAAACTTCTAGAGAGGAGAACATATAAGGACACAGGGAAGCAATTCAATGTGATTGCAGCA
TCTTGGATTCAATTTATGATACATGACTGGATAGATCATATGGAAGACACTCAGCAG
ATTGAACTCATTGCACCAAGAGAAGTTGTAAACCAATGCCCACTTAAATCTTTCAAGTTCTTC
AAGACAAAGGAAATCCCAACTGGCTTCTATGAGGTCCAGACCGGACATGCAAACATCCGTACACCTTGGTG
GGATGGAAGTGTGATATATGGAAGCAATCAAGAAGTTTTGGACAAAGTG
AGGACTTTCAAAGATGGTAAAATCAAAATATCAAAGGAAGGTGAACTTCTTCATAATGAAGATGGAACAGCAATTTCAGGTGACATTCGTAATAGTTGGGCTGGTGTCACAACTTTGCAG
ACCCTTTTTGTTCTAGAACACAATGCTGTGTGTGATTCTCTTAAG
AAGGAATACCCAGACTTGGAAGATGAAGATCTTTATCGCTATGCTAGACTGGTAACTTCAGCTGTGATAGCAAAG
ATTCACACCATAGATTGGACTGTGGAGCTTCTTAAAACTGACACTTTGCTTGGAGGCATGCGCGCCAATTG
GTATGGATTACTGGGAAAGAAATTCAAGGACACATTTGGGCATTCCGGA
AACTCCATATTGAGTGGATTTGTGGGCATGAAGAGAGCAGAAAATCATGGTGTTCCATACTCTTTAACTGAGGAATTTGCTAGTGTCTATAGAATGCATCCACTCCTGCCTGATTTCCTG
CACTTGAGAGACACATCTGCCTCTCCTGGGCCTAACAAATCTCCGCCATTAATCAAAGA
GATTCCTATGAACGATTTGATCGGACTACAAGGAGAGAAGACCTTGATAGAGATAGGAGTT
CAAAAACAATTGGTATCAATGGGTCACCAAGCTTGTGGGGCCCTAGAACTTTGGAACTATCCATCATGGCTCAGAAACCTAGTACCACATAACATGGATGGCACAGAAAGATCTGATCAT
GTGGACTTAGCTGCTCTTGAAA
TTTACAGGGATAGAGAGAGAGGTGTAGCAAGATATAACCAATTCAGGAGAGGACTATTCATGATACCTATTTCTAAATGGGAAGATTTAACAGATGAT
AAGGAAGTTATAAAAGTATTGGAAGAGATATATGGTGATGATGTTGAGGAGCTTGATGTGCTTGTAGGTCTCATGGCAGAGAAGAAGATAAAGGGTTTTGCAATTAGTGAGACAGCTTTT
TTAATCTTCCTTCTCATGGCATCTAG
GAGGCTAGAGGGTGATAGATTTTTCACAAGCAACTACAATGAGGAGACATACACTGAAAAGGGTTTGAAATGGGTGAACACAACTGAAACCTTA
AAGGATGTGATTGATCGTCACTACCCAAAAATGACAAACAAATGGTTGAATGCTTCAAGTGCTTTCTCTGTTTGGGATGCACCACCAAACAAACACAACCCTATTCCAATTTACTTGCGT
GTTCCTAGTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCACGGACA CACACATTTC ATCAAATTTA GTCCTGTATC AAGCAAAACC ATGTGGTCTA TAATAACGAA TCCCATTAAA ACCATCATTT CAAATATCAT ACACCATGCC ATCCATAAAG  ATTTCCATGC AGCAGTGGCA AAAATGTCCA TCATAGATGC TTTTCTCTTC CTTATTGTAC ACTCCATTGA CAAGTTGGGA ATATGGCACC GTTTACCTGT TTTCTTAGGG CTAATATACT  TGGCAATTAG GAGACATCTT CACCAAGAGT ACAATCTCAT CAATGTTGGA ACAACACCTG TAGGGGTTAG GTCAAACCCT ACTGATTTTC CATACAGAAC TGCTGATGGA AGATATAATG  ATCCTTTTAA TGAAAATGCT GGAAGCCAAG GATCTTTCTT TGGCAGAAAC ATTCTCCCTG TTGATCAGAA GAAAAAGTTG TTGAAACCAG ACCCAATGGT GGTGGCAACA AAACTTCTAG  AGAGGAGAAC ATATAAGGAC ACAGGGAAGC AATTCAATGT GATTGCAGCA TCTTGGATTC AATTTATGAT ACATGACTGG ATAGATCATA TGGAAGACAC TCAGCAGATT GAACTCATTG  CACCAAGAGA AGTTGTAAAC CAATGCCCAC TTAAATCTTT CAAGTTCTTC AAGACAAAGG AAATCCCAAC TGGCTTCTAT GAGGTCCAGA CCGGACATGC AAACATCCGT ACACCTTGGT  GGGATGGAAG TGTGATATAT GGAAGCAATC AAGAAGTTTT GGACAAAGTG AGGACTTTCA AAGATGGTAA AATCAAAATA TCAAAGGAAG GTGAACTTCT TCATAATGAA GATGGAACAG  CAATTTCAGG TGACATTCGT AATAGTTGGG CTGGTGTCAC AACTTTGCAG ACCCTTTTTG TTCTAGAACA CAATGCTGTG TGTGATTCTC TTAAGAAGGA ATACCCAGAC TTGGAAGATG  AAGATCTTTA TCGCTATGCT AGACTGGTAA CTTCAGCTGT GATAGCAAAG ATTCACACCA TAGATTGGAC TGTGGAGCTT CTTAAAACTG ACACTTTGCT TGGAGGCATG CGCGCCAATT  GGTATGGATT ACTGGGAAAG AAATTCAAGG ACACATTTGG GCATTCCGGA AACTCCATAT TGAGTGGATT TGTGGGCATG AAGAGAGCAG AAAATCATGG TGTTCCATAC TCTTTAACTG  AGGAATTTGC TAGTGTCTAT AGAATGCATC CACTCCTGCC TGATTTCCTG CACTTGAGAG ACACATCTGC CTCTCCTGGG CCTAACAAAT CTCCGCCATT AATCAAAGAG ATTCCTATGA  ACGATTTGAT CGGACTACAA GGAGAGAAGA CCTTGATAGA GATAGGAGTT CAAAAACAAT TGGTATCAAT GGGTCACCAA GCTTGTGGGG CCCTAGAACT TTGGAACTAT CCATCATGGC  TCAGAAACCT AGTACCACAT AACATGGATG GCACAGAAAG ATCTGATCAT GTGGACTTAG CTGCTCTTGA AATTTACAGG GATAGAGAGA GAGGTGTAGC AAGATATAAC CAATTCAGGA  GAGGACTATT CATGATACCT ATTTCTAAAT GGGAAGATTT AACAGATGAT AAGGAAGTTA TAAAAGTATT GGAAGAGATA TATGGTGATG ATGTTGAGGA GCTTGATGTG CTTGTAGGTC  TCATGGCAGA GAAGAAGATA AAGGGTTTTG CAATTAGTGA GACAGCTTTT TTAATCTTCC TTCTCATGGC ATCTAGGAGG CTAGAGGGTG ATAGATTTTT CACAAGCAAC TACAATGAGG  AGACATACAC TGAAAAGGGT TTGAAATGGG TGAACACAAC TGAAACCTTA AAGGATGTGA TTGATCGTCA CTACCCAAAA ATGACAAACA AATGGTTGAA TGCTTCAAGT GCTTTCTCTG  TTTGGGATGC ACCACCAAAC AAACACAACC CTATTCCAAT TTACTTGCGT GTTCCTAGTT AATCAATTTA AGTTAGCATT ATATCTATGT TGTATTTGTG TTTATACATA CACATTTATG  TTTATGTGTA TGTATTGGTG TTTATTTATT TGTTGATTTG TATCTTTCAA AATAATCATC TGTCCGTTCA AGAATAAAAT CATGTTTTGT ATTTCAAAAA AAAAAAGAAA AACTAGTTTT 
TTATTTGTAT TATGATGTTT CTAAGTTAAT ATAATGATGC TTAAACTGTA AACTTAACGT TGCACTACAA CATAAT 

Retrieve as FASTA