Entry information : AtKat02 (CAT2 / At4g35090)
Entry ID 5141
Creation 2007-04-06 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtKat02 (CAT2 / At4g35090)
Name (synonym) AtKat02 (CAT2 / At4g35090)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtKat02
start..stop
S start..stop
AlyKat02 1024 0 1..492 1..492
RsKat01 1019 0 1..492 1..492
BjKat02 1018 0 1..492 1..492
BjKat03 1014 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16703201..16703215 15 N° 2 16702844..16702940 97 N° 3 16702490..16702767 278 N° 4 16701635..16702411 777
N° 5 16701463..16701552 90 N° 6 16701294..16701361 68 N° 7 16701111..16701204 94 N° 8 16700937..16700996 60
complement(join(16700937..16700996,16701111..16701204,16701294..16701361,1670146 3..16701552,16701635..16702411,16702490..16702767,16702844..16702940,16703201..1 6703215))


exon

Literature and cross-references AtKat02 (CAT2 / At4g35090)
Literature Chevalier C., Yamaguchi J., McCourt P.;
"Nucleotide sequence of a cDNA for catalase from Arabidopsis thaliana.";
Plant Physiol. 99:1726-1728(1992).
Protein ref. UniProtKB:   P25819   Q940G2 UniProtKB_Uniparc:   Q2V3B7 [Mismatch]
DNA ref. Phytozome 12:   Chr4 (16703215..16700937)
mRNA ref. GenBank:   NM_001036714
Cluster/Prediction ref. Phytozome Gene 12:   19644440 UniGene:   At.24350
Omic ref. ePlant:   At4g35090 TAIR:   At4g35090
Protein sequence: AtKat02 (CAT2 / At4g35090)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56782.27  
PI (pH):   %s   7.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPASSYNSPFFTTNSGAPVWNNNSSMTVGPRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDISNLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFIRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLNMFTFLFDDIGIPQDYRHMDGSGVNTYMLINKAGKAHYVKFHWKPTCGVKSLLEEDAIRVGGTNHSHATQDLYDSIAAGNYPEWKLFIQIIDPADEDKFDFDPLDVTKTWPEDILPLQPVGRMVLNKNIDNFFAENEQLAFCPAIIVPGIHYSDDKLLQTRVFSYADTQRHRLGPNYLQLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRYDQVRHAEKYPTPPAVCSGKRERCIIEKENNFKEPGERYRTFTPERQERFIQRWIDALSDPRITHEIRSIWISYWSADKSLGQKLASRLNVRPSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns), 7 mRNA and 440 ESTs. Cultivar="Landsberg erecta" and "Columbia". Three SwissProt/TREMBL accessions: P25819, Q940G2 and Q2V3B7 (1 mismatch).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTCTAATTA TTATTAAAAA AACAAAAATT AACCATAAGG TGAGTTTGTT TTGTGTATCC TTCTTATTTT TAACCAAGAA GGAACTTACA TCAAGATTAG TTGAAATTTT CAAAAAGACG  ACACGTGCTG AGAAAAATAT GTTCTTGATC CTTGACATTG GAAATGGAAG TAGTAGCTAG CTACTTAATC GTTGTATATC TTTAAGAGTT GGGCTAGACC AGATAATTCA GCCCATTTTG  ATGTATTAGC GACAATTCTT TTGATAGCAT TTTTGGGCTA AGTCTATTCG TAATGGGTTT CAATCATCTC ATTGTTTCTT CAGCACATTT TTGAGCCTGC TTATTTTTTT TCAGAACGTA  TGGAACAAGA TCACATGTTT AATTATGTAT GGTCGACATG TTTCAATCCG TTGGCTTTAA GGTCTTAATA ACGTACGATA CATTAGTTTT GTTTTGTTGC ATGTAACCTG TGTGGTTGTA  CTTGTACGTT CACTACTTGT TGGTTTCTTT ATAACCAATA GAATTCGGCA ATTCAGTACC ATGTATATGT TTTTCTTAAC CGACCATATA TTCCATAATT CACATGCCAT CTCTTAAAAG  AAATACAAGC ACTCATAGCC ATAGGTGGTG GATGAAGAAA TATGTGTGTT AAAAATTTCT TCTATTGTCC AAAATCAACA GCTTGATCAG ATGAACTTCT GAGCGAGCCA GAGGGTTCCA  AGGTGGGCCA TTGGGAACTT GATAAATCTC ATCTCGTCAC ATCTCCCAAG GGGCAAAACA AAAACTTAAG AAATAATCAA TTCAAAAGGC ATATTCTTCC CGCTTGGGGC GTTCACACTA  TCTCATCACA CGTGGAATCC AACAAAGCAG CCACGTCACC CAAGACCATA CTAAACCACT TAAAAAGGTT TTGCTAAAAG GCCAAAAAAA CCGGATAAGG AACCACAGCC CAATGACGTC  CTCATTTATT TTATTTTCAT TGAATTGCCT AATATTTATT TCTTTTGTCG TCCTTCTTCC TTGCTTTTGT TACCATATAA AAAAAACTTT TTTTTTAAGT ACAGAATATA TATATGACAA  TATCGCAATC GTGGGTTCAG CTTATCTTAA GTTCTCGGGA ACCTAAATTC GGATCGCATT GACGATGTTG ATCTATCAAA CCACAGCCAG TTAGTTTATA AGGTTCAAAA TTAATCGTTT  ATCAAAAACT ACATGTAAGT TGGCTTTGTT CAACGAATTT TTAGAAAAAC GTAAAACGAT ATAATTTGGC AGGACCAAAT AAAAACCAAT GCCATGGATT TCATCTTCTA TTACATCATA  GAATAGATTC AATTCTGTAA GGGTTGACTT TGTTTTAATC ATTATTCTAC ATTCTCTAAT AATAATAGAT TTTGTTAAAC TTGTTAATGT GATGTAAATC AAAAGTACAG TTATTTGCTA  TGAGTGTCTG AGATTAAAAG ATAGTCGCAC TAATTCATTT AGATTAGTTT ATAATCCAAT TAACAAAATA AAAATGAGCG AATAAAACAA ATTAAAACTA CTTTTTCTGA ATTTGAATAA  ATAGTAGGTA ACCGGTGGTT GGATTAAGAA AAATATATAT GAAACAATTC GTGGTACTGT GATCATAAAT AATACTTGAC GTTCCTGAAT TTCTCGCCAC AATATATAAC ATTTGTTTTT  TTCTTTCCAG TATTTATCAC ATGAAAAAAC TAAAATAAAG AAAAAACGAT AACCTTTAAA AATTCCCCCC TCAAAATAAA GAAAAAAATA AAAAGCTAAA AAGGCAGTAA TACACACGCC 
ATTTATAAAT AAGGCAAGTG AATATAAAAT AGTGCCTCAT CATCATCAGT ACCATCTCCT CGTTTTGATA AAAATCTCTG AATCTCTCCA AGCTCTCTTC TCATCAAACC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACGAGTGAA AGAATTCTTG ATTGGCCTTT CTGTGGTTGT TAATTAGCAG AGAAAAGAAA ATGGGAAGAG ATCAAAGTTG CGATAATACA ATCTTCATCA TGTGGATCTT CTGTGCTATG  TTATAATAGT ATCTGTTTAA AGACCAAAAG AACCTTGTGT GTTGTTGTGT CTCTCGTTTA TCAGAATAAT ACATTATACA TTGAAGATTT ATAATCCGTG GTGTTACTTG ATGAAAGCTC  CTTCTTCCTT GAAAGATTGT GACATATTCT TATATATTTC TCATATATTA ACGAATGTAA TCCCGTAAGA GCTGTCGACA AAGACGTGAT TTTTAGTCTG CATGTTCTGG ACGAAAGGGA  ATAGCAAAGT ATGAAACGAA AAAGACAAGA AAATCCATAA ATTCTTATGT GTGGGTATTA GGGAATTTAC AATAGTTGTC AATATGTGTT GTAACAGTGG CCACATTTGT GTATAACGTC  GTTGTATCAA GTGTGGGGTG TCGAGAGTCT TTAGATTTGG TGTGAATAAT CTGACAATTT GGATTTGAAC TCTGCTTTGA CATCCTGACA TTAGAAAATA AACTTGGTTT TGACATTTTG  GGGTTTGTAT TTGTGACAAG TACTGTTCAA ATGATATAAA CAAGAATGAC TTTTTAGTTA AAATTTGATA ATATTACAAA GTATGGTTAC ATGCAGTTGA TCGATAATTC AGAACCAAAA  CCAAACTTCT CTTAAAAATA AGGAAAATAA AAAGAATCAC CAAATGGTTT TCTCCGAGAG GAGTTTCTGA AGCAAGATTA CGAGATTTTG TTCGTACAGG TGACAATAAT ACGAGTGATA  TGGACCCAAA AAAACCTCTC TTTCTTCTAT AAGAACTACA AAGATTTCAA CTTGTCTCAT TTACCTGAAG AAGCTTTTAC TTTCTCAGTA GAGGCTAAAA CCAAAGAAAG GGCTGATGAC 
AATTCCCAAT CCAAGACCAA TAGCCACAAG TGACGAAACC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTAAACCCTTCTTTCTTTTCTCTCTAACCTTTTCGTCTTTTGTAATTTCTCCGTATAAACTGGATTGAAACGTTGTTATTAGCTTATGGAATTGCACCCAAAGTT
TTGACCTTTTTTTCTACTCGAATCTGCAAATATACAATTAAGTCTTTCCATTGCTCTAAGATCATGTGCCTTTTGACTTGTGATTCTTTCGAATCATTGTGGTTTTTCTCTGATGTTAAT
TTTAATTTCCTTTGCAATTGATGATGATGATGCAGTATCGTCCAGCTAGTTCTTACAACTCTCCCTTCTTCACCACCAACTCTGGTGCTCCTGTATGGAACAACAACTCCTCCATGACCG
TTGGACCCAGAG
GTACCTCTTCTTCTCCCATGAATAAGTCTGTTCTCCTCAATGTTATTGTTGCATTTCTGATTGTTTTTTTGGGCAGGTCCTATCCTTCTTGAGGATTACCATCTCGTT
GAGAAGCTTGCCAATTTCGACAGGGAACGGATTCCAGAGCGTGTGGTTCATGCCAGAGGAGCCAGTGCTAAAGGTTTCTTTGAGGTCACTCATGATATCTCTAACCTCACTTGTGCTGAC
TTTCTCCGAGCTCCCGGTGTTCAGACTCCTGTCATTGTCCGGTTCTCCACCGTTATCCATGAGCGTGGAAGTCCCGAGACCTTGAGAGACCCTCGTGGTTTTGCAGTCAAGTTCTACACC
AGAGAG
GTCAGTTAGTAGTTTGTAACATTTAAGAATGCTAGCAATTACTTATATACTAAGCAAATGATCATTCTTTGTATGCAGGGGAACTTTGATCTTGTTGGAAACAACTTTCCTGTT
TTCTTCATCCGCGATGGGATGAAGTTCCCTGACATGGTCCACGCTCTTAAGCCGAACCCAAAATCTCACATCCAAGAGAACTGGAGAATCCTTGACTTCTTCTCCCACCACCCTGAAAGT
TTGAACATGTTCACTTTCCTCTTCGATGATATCGGTATCCCACAAGATTACAGGCACATGGATGGTTCAGGTGTCAATACATACATGTTGATCAACAAAGCTGGCAAAGCTCACTACGTG
AAGTTCCATTGGAAACCAACTTGTGGAGTCAAGTCTCTTTTGGAAGAAGATGCAATTCGTGTTGGAGGAACCAACCACAGTCATGCGACTCAAGACTTGTATGACTCTATAGCTGCTGGA
AACTACCCTGAATGGAAGCTCTTTATCCAAATCATTGATCCTGCTGATGAAGACAAGTTCGACTTTGACCCGCTCGATGTGACCAAGACCTGGCCTGAGGATATCTTGCCTCTTCAACCT
GTTGGACGTATGGTGTTGAACAAGAACATTGACAACTTCTTTGCAGAGAATGAGCAACTTGCTTTCTGTCCTGCAATTATTGTCCCAGGGATACATTACTCAGATGATAAGCTGCTTCAA
ACCCGTGTCTTCTCCTATGCCGATACTCAGAGACACCGTCTTGGACCAAACTACCTTCAGCTGCCAGTCAATGCTCCAAAATGTGCTCACCACAACAACCACCATGAGGGATTCATGAAT
TTCATGCACAGGGACGAGGAG
GTACTTAATAGTACACTATCAATATCTTTATATCGAACTTGAAGCTAGAATACCATAGTCTTACAAGAAGCTGTTGTTACAGGTTAACTACTTCCCGTC
GAGGTATGACCAGGTTCGTCATGCTGAGAAGTATCCAACTCCGCCTGCTGTCTGTTCTGGAAAACGTGAGAGG
GTCAGTAATCAACTCTGTTTTCCTCTCTGTTTCTGTTTCCCATGGAT
TGGTTCACTTAAGAACATATGATCTAAAAGTTTCGAAATCTGTTTTTTTTTCAGTGCATTATTGAGAAAGAGAACAACTTCAAGGAGCCTGGAGAGAGATACCGTACCTTTACACCAGAG
AG
GTACTAATTGTTTTATTTTTGTAATGATGCTTAATGCATAAAAGGAACATCTGTGTTCTTAACGTTTTACGGTATGTTTTCAACTTCAGGCAAGAACGATTCATCCAGAGATGGATTG
ATGCCCTATCCGACCCACGCATCACGCATGAAATCCGCAGTATCTGGATCTCTTACTGGTCTCAG
GTCTGAAATCTTGATCTCTGTTACTGTCATTGTCTCGTTCTTCAAGTCTCAGCAG
TTGAAAAGTTGTCAAGTTTTAAACATTTTTGACTGATTGGTTAAAAATGTGTGAAACAGGCTGATAAGTCTTTGGGACAGAAGCTGGCAAGCCGTCTGAACGTGAGACCAAGCATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGTATCGTCCAGCTAGTTCTTACAACTCTCCCTTCTTCACCACCAACTCTGGTGCTCCTGTATGGAACAACAACTCCTCCATGACCGTTGGACCCAGAGGTCCTATC
CTTCTTGAGGATTACCATCTCGTTGAGAAGCTTGCCAATTTCGACAGGGAACGGATTCCAGAGCGTGTGGTTCATGCCAGAGGAGCCAGTGCTAAAGGTTTCTTTGAGGTCACTCATGAT
ATCTCTAACCTCACTTGTGCTGACTTTCTCCGAGCTCCCGGTGTTCAGACTCCTGTCATTGTCCGGTTCTCCACCGTTATCCATGAGCGTGGAAGTCCCGAGACCTTGAGAGACCCTCGT
GGTTTTGCAGTCAAGTTCTACACCAGAGAG
GGGAACTTTGATCTTGTTGGAAACAACTTTCCTGTTTTCTTCATCCGCGATGGGATGAAGTTCCCTGACATGGTCCACGCTCTTAAGCCG
AACCCAAAATCTCACATCCAAGAGAACTGGAGAATCCTTGACTTCTTCTCCCACCACCCTGAAAGTTTGAACATGTTCACTTTCCTCTTCGATGATATCGGTATCCCACAAGATTACAGG
CACATGGATGGTTCAGGTGTCAATACATACATGTTGATCAACAAAGCTGGCAAAGCTCACTACGTGAAGTTCCATTGGAAACCAACTTGTGGAGTCAAGTCTCTTTTGGAAGAAGATGCA
ATTCGTGTTGGAGGAACCAACCACAGTCATGCGACTCAAGACTTGTATGACTCTATAGCTGCTGGAAACTACCCTGAATGGAAGCTCTTTATCCAAATCATTGATCCTGCTGATGAAGAC
AAGTTCGACTTTGACCCGCTCGATGTGACCAAGACCTGGCCTGAGGATATCTTGCCTCTTCAACCTGTTGGACGTATGGTGTTGAACAAGAACATTGACAACTTCTTTGCAGAGAATGAG
CAACTTGCTTTCTGTCCTGCAATTATTGTCCCAGGGATACATTACTCAGATGATAAGCTGCTTCAAACCCGTGTCTTCTCCTATGCCGATACTCAGAGACACCGTCTTGGACCAAACTAC
CTTCAGCTGCCAGTCAATGCTCCAAAATGTGCTCACCACAACAACCACCATGAGGGATTCATGAATTTCATGCACAGGGACGAGGAG
GTTAACTACTTCCCGTCGAGGTATGACCAGGTT
CGTCATGCTGAGAAGTATCCAACTCCGCCTGCTGTCTGTTCTGGAAAACGTGAGAGG
TGCATTATTGAGAAAGAGAACAACTTCAAGGAGCCTGGAGAGAGATACCGTACCTTTACACCA
GAGAG
GCAAGAACGATTCATCCAGAGATGGATTGATGCCCTATCCGACCCACGCATCACGCATGAAATCCGCAGTATCTGGATCTCTTACTGGTCTCAGGCTGATAAGTCTTTGGGACAG
AAGCTGGCAAGCCGTCTGAACGTGAGACCAAGCATCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTATAAAT AAGGCAAGTG AATATAAAAT AGTGCCTCAT CATCATCAGT ACCATCTCCT CGTTTTGATA AAAATCTCTG AATCTCTCCA AGCTCTCTTC TCATCAAACC ATGGATCCTT  ACAAGTATCG TCCAGCTAGT TCTTACAACT CTCCCTTCTT CACCACCAAC TCTGGTGCTC CTGTATGGAA CAACAACTCC TCCATGACCG TTGGACCCAG AGGTCCTATC CTTCTTGAGG  ATTACCATCT CGTTGAGAAG CTTGCCAATT TCGACAGGGA ACGGATTCCA GAGCGTGTGG TTCATGCCAG AGGAGCCAGT GCTAAAGGTT TCTTTGAGGT CACTCATGAT ATCTCTAACC  TCACTTGTGC TGACTTTCTC CGAGCTCCCG GTGTTCAGAC TCCTGTCATT GTCCGGTTCT CCACCGTTAT CCATGAGCGT GGAAGTCCCG AGACCTTGAG AGACCCTCGT GGTTTTGCAG  TCAAGTTCTA CACCAGAGAG GGGAACTTTG ATCTTGTTGG AAACAACTTT CCTGTTTTCT TCATCCGCGA TGGGATGAAG TTCCCTGACA TGGTCCACGC TCTTAAGCCG AACCCAAAAT  CTCACATCCA AGAGAACTGG AGAATCCTTG ACTTCTTCTC CCACCACCCT GAAAGTTTGA ACATGTTCAC TTTCCTCTTC GATGATATCG GTATCCCACA AGATTACAGG CACATGGATG  GTTCAGGTGT CAATACATAC ATGTTGATCA ACAAAGCTGG CAAAGCTCAC TACGTGAAGT TCCATTGGAA ACCAACTTGT GGAGTCAAGT CTCTTTTGGA AGAAGATGCA ATTCGTGTTG  GAGGAACCAA CCACAGTCAT GCGACTCAAG ACTTGTATGA CTCTATAGCT GCTGGAAACT ACCCTGAATG GAAGCTCTTT ATCCAAATCA TTGATCCTGC TGATGAAGAC AAGTTCGACT  TTGACCCGCT CGATGTGACC AAGACCTGGC CTGAGGATAT CTTGCCTCTT CAACCTGTTG GACGTATGGT GTTGAACAAG AACATTGACA ACTTCTTTGC AGAGAATGAG CAACTTGCTT  TCTGTCCTGC AATTATTGTC CCAGGGATAC ATTACTCAGA TGATAAGCTG CTTCAAACCC GTGTCTTCTC CTATGCCGAT ACTCAGAGAC ACCGTCTTGG ACCAAACTAC CTTCAGCTGC  CAGTCAATGC TCCAAAATGT GCTCACCACA ACAACCACCA TGAGGGATTC ATGAATTTCA TGCACAGGGA CGAGGAGGTT AACTACTTCC CGTCGAGGTA TGACCAGGTT CGTCATGCTG  AGAAGTATCC AACTCCGCCT GCTGTCTGTT CTGGAAAACG TGAGAGGTGC ATTATTGAGA AAGAGAACAA CTTCAAGGAG CCTGGAGAGA GATACCGTAC CTTTACACCA GAGAGGCAAG  AACGATTCAT CCAGAGATGG ATTGATGCCC TATCCGACCC ACGCATCACG CATGAAATCC GCAGTATCTG GATCTCTTAC TGGTCTCAGG CTGATAAGTC TTTGGGACAG AAGCTGGCAA  GCCGTCTGAA CGTGAGACCA AGCATCTAAA ACGAGTGAAA GAATTCTTGA TTGGCCTTTC TGTGGTTGTT AATTAGCAGA GAAAAGAAAA TGGGAAGAGA TCAAAGTTGC GATAATACAA  TCTTCATCAT GTGGATCTTC TGTGCTATGT TATAATAGTA TCTGTTTAAA GACCAAAAGA ACCTTGTGTG TTGTTGTGTC TCTCGTTTAT CAGAATAATA CATTATACAT TGAAGATTTA  TAATCCGTGG TGTTACTTGA TGAAAGCTCC TTCTTCCTTG AAAGATTGTG ACATATTCTT ATATATTTCT CATATATTAA CGAATGTAAT CCCGTAAGAG CTGTCGACAA AGACGTGATT 
TTTAGTCTGC 

Retrieve as FASTA