Entry information : AtKat01 (CAT1 / At1g20630)
Entry ID 5142
Creation 2007-04-06 (Christophe Dunand)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtKat01 (CAT1 / At1g20630)
Name (synonym) AtKat01 (CAT1 / At1g20630)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtKat01
start..stop
S start..stop
AlyKat01 1020 0 1..492 1..492
ThasKat01 951 0 1..492 1..492
BnKat02_other 943 0 1..492 1..492
NtKat03-1B 931 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7146812..7146826 15 N° 2 7147413..7147509 97 N° 3 7147783..7148060 278 N° 4 7148239..7149015 777
N° 5 7149106..7149195 90 N° 6 7149286..7149353 68 N° 7 7149456..7149609 154  
join(7146812..7146826,7147413..7147509,7147783..7148060,7148239..7149015,7149106 ..7149195,7149286..7149353,7149456..7149609)


exon

Literature and cross-references AtKat01 (CAT1 / At1g20630)
Literature Frugoli J.A., Zhong H.H., Nuccio M.L., McCourt P., McPeek M.A., Thomas T.L., McClung C.R.;
"Catalase is encoded by a multigene family in Arabidopsis thaliana (L.) Heynh.";
Plant Physiol. 112:327-336(1996).
Protein ref. UniProtKB:   Q96528
DNA ref. Phytozome 12:   Chr1 (7146812..7149609)
Cluster/Prediction ref. Phytozome Gene 12:   19651577 UniGene:   At.26213
Omic ref. ePlant:   At1g20630 TAIR:   At1g20630
Protein sequence: AtKat01 (CAT1 / At1g20630)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56579.25  
PI (pH):   %s   7.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYRVRPSSAHDSPFFTTNSGAPVWNNNSSLTVGTRGPILLEDYHLLEKLANFDRERIPERVVHARGASAKGFFEVTHDITQLTSADFLRGPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFVRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLFDDLGIPQDYRHMEGAGVNTYMLINKAGKAHYVKFHWKPTCGIKCLSDEEAIRVGGANHSHATKDLYDSIAAGNYPQWNLFVQVMDPAHEDKFDFDPLDVTKIWPEDILPLQPVGRLVLNKNIDNFFNENEQIAFCPALVVPGIHYSDDKLLQTRIFSYADSQRHRLGPNYLQLPVNAPKCAHHNNHHDGFMNFMHRDEEVNYFPSRLDPVRHAEKYPTTPIVCSGNREKCFIGKENNFKQPGERYRSWDSDRQERFVKRFVEALSEPRVTHEIRSIWISYWSQADKSLGQKLATRLNVRPNF

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns), 5 cDNA and 59 ESTs. Two SwissProt/TREMBL accessions: Q96528 and Q0WUH6. Cultivar="Landsberg erecta" and "Columbia".
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTACTGTTA TGATCAGGGA AACTTTGATC TTGTTGGGAA CAACACTCCG GTGTTCTTCA TCCGTGATGG GATTCAGTTC CCGGATGTTG TCCACGCGTT GAAACCTAAC CCGAAAACAA  ACATCCAAGA GTACTGGAGG ATTCTGGACT ACATGTCCCA CTTGCCTGAG AGTTTGCTCA CATGGTGCTG GATGTTTGAT GATGTTGGTA TTCCACAAGA TTACAGGCAC ATGGAGGGTT  TCGGTGTCCA CACCTACACT CTTATTGCCA AATCTGGAAA AGTTCTCTTT GTGAAGTTCC ACTGGAAACC AACTTGTGGG ATCAAGAATC TGACTGATGA AGAGGCCAAG GTTGTTGGAG  GAGCCAATCA CAGCCACGCC ACTAAGGATC TCCACGATGC CATTGCATCT GGCAACTACC CCGAGTGGAA ACTTTTCATC CAGACCATGG ATCCTGCAGA TGAGGATAAG TTTGACTTTG  ACCCACTTGA TGTGACCAAG ATCTGGCCTG AGGATATTTT GCCTCTGCAA CCGGTTGGTC GCTTGGTTCT GAACAGGACC ATTGACAATT TCTTCAATGA AACTGAGCAG CTTGCGTTCA  ACCCGGGTCT TGTGGTTCCT GGAATCTACT ACTCAGACGA CAAGCTGCTC CAGTGTAGGA TCTTTGCTTA TGGTGACACT CAGAGACATC GCCTTGGACC GAATTATTTG CAGCTTCCAG  TCAATGCTCC CAAATGTGCT CACCACAACA ATCACCATGA AGGTTTTATG AACTTCATGC ACAGAGATGA GGAGGTACGT CTTAGTACAC CACTTGAGCT ACCATTGTTA GTCTTTTTAC  TTGGAATCAA AATTCTCATT TGGTTTGTAC TTTTTACAGA TCAATTACTA CCCCTCAAAG TTTGATCCTG TCCGCTGCGC TGAGAAAGTT CCCACCCCTA CAAACTCCTA CACTGGAATT  CGAACAAAGG TCCGATTCCT GCCATGCCTT CTCTAAATCT TCAAATCCTA AACTCAAGTT TATTAGAATA TTGGTGCTAA GAAAACCTTT TAATTGCTAA TGTTGCAGTG CGTCATCAAG  AAAGAGAACA ACTTCAAACA GGCTGGAGAC AGGTACAGAT CATGGGCACC AGACAGGCAA GACAGGTTTG TTAAGAGATG GGTGGAGATT CTATCGGAGC CACGTCTCAC CCACGAGATC  CGCGGCATCT GGATCTCTTA CTGGTCTCAG GTCAGAACAA AAAAACACTC GGTCAAATTT CTACGTCCTT TTTACCAAGT TTCAGCAAAC TAAAACATTA TTTATCTCTC TGTATCTCTC  AGGCTGATCG ATCCTTGGGA CAGAAACTTG CAAGCCGTCT GAACGTGAGG CCAAGCATCT AGAGGCCAAT CTCCATATAA GCTCAGTCTA TGTGAGGTAC AATCAATCTC ATCGATCTAT  CATCGCTTGG TCGTTAAATC CGTCAAAAAG ATAATCACAT GTGTTGTTGT TTCTTGTCTA TATAATAATA ATGCTTGTAA TCCCAAAAAC TCATGTTTCC TTCCTTTCTA CTCTCACTGT  CTTTGTAATC TCTTTTTACA ATAAATCAAT GTTTCTTGAA GCAGTAAACA ATTTCTAAGA TTTATGGTGG TCGTTATACA TATTATTAAT TCAGGAAAAA AAAGAGAAGA TACCGTAATT  GAACATGTAT TATTTTAAGG AGAATCCTGA AATGGATCAA CAATTGTCTA ATTATGGTAT AGTATCTGGC GAAATCAAAG ACGATATCAT CCACACGTAA TTAGTTTGAC TATTAATACG  AGGATTATCA TTTGGATAAG GATTAACAAA GACAAAACAC ATACGTGTTT TGGTGTTGAG CTAAAATAAG ATATTTTGGC TCTCGCTATA AAAAAAAAAT CGACAACAGT GCAGACACAC 
GCCGATTTGC GAGATACACA CAGTCTCACC TAAAAATCGC AAAAGAAGAA AAATTCGGAT CAAAATTGTC TTCAAGCATC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATATCAT CTCTAAAGAC TAAGTGAAAT CCTATAAACT CAATATGCTC CTCTTACGGT TTGGTTTCTA AGTAATCTCG TTTATTGACA ATGAAACGCT TAAAGAAGGG TACTAGTTCC  TGTTTGTAAT CTTCTTTTCA AAATATTAAC GATTATTTTC TAAGGCAAAT AAATAAAAAG CTATGACTAA TATAGCTTAG TAAACAAGTA TCACTATCAT CCATTTGGTT CTACTTTAAA  AATGGATTTT TATTTGTATT TTAATCTTCT GCATCTATGA CGTGAGCTTA TAGTTGGAAT TTTATTGGGG TCTAATGTCA GACGCACGAT CTTGATAAAA AAGTTTTATG TCTGTCCATA  TTTTGATAAA TTGGCATAGT CATCACTCAT CACGTCAGAC CTTTTAATTG GTCAATCGTT ATGATGCTAC ATCGCATTCA TAATTTATAA TTTACATGTA AGTGGGGGTG GAGTATTTGA  TTATTCCGCT GCTAGTGGAA ATGCAAAAAG AATAATGAGA GCAGACCAAT TTTAATTATG CTTATACTTT GTTGCGCTTA ACTTTTAATC AGCTAATACA GTCTGATTAA TCTGATGTCT  CTCAGCCAGT AGTTTCTTTT CTTAAAGAGA ACCTCAGCGC AAATCAGAAA TTAGACACAT GGAGCCACAT CAAACTTAAT CACCAATAAT ATCCTTTTCT CATGTATTTT TCAGTCTCAT  ATTTTTTTTT ACAACTTGTT AAGTGGTAGT GTGCGAAGAT TTTAGATCGA AGTTACGCAT CTTAAGAGAT TATTTATCCA ATGAAATGGT ATAGTGAACT GTGTTTGCTA ATGGTCCAGG  ATTTTATACA TTTAAAATTC ATAACTTTGC AGTTTAACGA AAAACAATAA CAAATTTAAC GTGTTTTGGT TGTCGTTAAC AAGATCTCGG ATCCATTTAG GAAAAGTCAA TATCTTGATG 
ACGAAATCAA GAAGACTTTA CTTTGATTGC ATGTGACGGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAGGGTACATCGATTGATTCTCTTTTTTTGTAATCTGTGATTTTACCTTACTTGATTTCGTATCGATTTGGTGTGATTTCGTGTTGAATCCAAAGTGTATGAATGATCT
CTCTCTCTCGGTTAAAATGATGCAAAATTGGGGTGATTGTTCGACTTGTTGAGGTTTTTTTGTGTGAATCGATTTCTTTATTATATAGTGGAGATTGGGTTTCGATTTGCATGCGTTGAA
GATTCCACTGGAAAATTCAACATGTTTTTCCGTCTATTGATTGTTTATTTGTCAACATGCTCATGCTCATGCTCATGTTCTAATACACAAGTCTTAAGGCTGACGTGATCTGTCAATATC
GTTGTACATGTTTTAAGGTTTCTTTACGATTTTTTTAAAGTTATTTTAATCACTGTGTTCAATTGTGAATATCATTGTTGCTTGTATCGTATTTTTTTAATTGATCATATATACTTATGT
GGAATTGTTATGTATCAAGTATCAATGTATCATTATTTGTCATAGACGTTTCTCCAATCTATGGAAATTTGGTTAATTTTTTTGTGATCCAGTTCTTCTGAATTTATTTGTTGGTGTGCA
GGTTCGTCCTTCAAGCGCTCATGATTCCCCTTTCTTCACTACAAACTCGGGTGCTCCTGTCTGGAACAACAACTCTTCTTTGACTGTCGGAACTCGAGGTCCGTTTCTCTTTCTTATCTC
TTGAATACAAATTATAACAAATATGTTGAACCAGTGGTTGTTAGAAATGCCCTTAAAGCTAGAGTAGTGGAAGCCAAATAATTTTATAAACGTTTGGATAATAATGTCATTAGTGTTTTT
GTTGTGGACTTGCGTAAATCACATTTCTTCCTTCAGTTTTATGCCAAATCTGATATAATTCCTCAATGTTGATTCTGTCTCAGTTGCTTGGATTTTTAGATATGTTAAGCGATGGTTTTA
TATATTGTCAGGTCCAATCCTTCTGGAGGACTATCATCTGCTTGAGAAACTCGCTAACTTTGACAGGGAGCGGATTCCTGAGAGGGTTGTTCATGCCAGGGGAGCCAGTGCTAAGGGTTT
CTTTGAAGTCACTCATGACATTACCCAACTTACTTCTGCTGATTTTCTTCGAGGACCTGGTGTTCAGACTCCTGTTATCGTTCGTTTCTCAACTGTCATCCATGAGCGTGGCAGTCCCGA
GACTCTCAGAGATCCCCGTGGTTTTGCTGTTAAGTTTTACACCAGAGAG
GTTAGCTTTTTGTCTTATCCTTCCATTGTCTCTCTATTTTCTATAACCGATATCGATGTGTTTGCTGATAT
TCAAACGTTTATTTGCTTATCTATTTCGTTTCACCACCTATATGATTACTTGCAAATCATATCATACTATACTGATGATTCCTCTTACCCTCTGTTTGCAAACTCAGGGGAACTTTGATC
TTGTTGGGAACAACTTCCCTGTATTCTTCGTCCGTGATGGAATGAAATTCCCTGACATGGTCCATGCATTGAAACCGAATCCCAAGTCTCACATTCAGGAGAACTGGAGGATACTGGACT
TCTTCTCCCACCACCCAGAGAGTTTGCACATGTTTTCATTTCTCTTTGATGATCTCGGTATCCCACAGGACTACAGGCACATGGAAGGCGCTGGGGTCAACACTTACATGCTAATCAACA
AAGCTGGAAAAGCTCACTATGTGAAATTCCACTGGAAGCCGACTTGTGGGATCAAATGCCTGTCGGATGAGGAAGCTATCAGAGTTGGAGGAGCCAATCACAGCCATGCCACCAAAGATC
TCTATGACTCGATCGCAGCCGGGAACTATCCGCAGTGGAATCTCTTCGTTCAGGTGATGGATCCTGCCCATGAAGACAAATTTGACTTCGATCCGCTTGATGTCACAAAGATCTGGCCTG
AAGATATCTTGCCTTTACAACCTGTTGGTCGCTTGGTCTTGAACAAAAACATCGACAACTTCTTTAATGAGAACGAACAGATTGCATTCTGTCCTGCTCTTGTGGTTCCAGGCATCCACT
ATTCAGATGATAAGCTACTCCAGACCCGGATCTTCTCCTACGCTGATAGTCAGAGACACCGTCTTGGACCAAACTATCTGCAACTACCTGTTAATGCCCCTAAATGTGCTCACCACAACA
ATCACCATGATGGTTTTATGAACTTCATGCACAGGGATGAGGAG
GTAATCTTATCTCTCGGCTCTAGAAACTCCCAGATACTTAAATTCGCAATCACATTTATATGAAGTGAATTTGTTG
CTTTCCAATTCCAGGTCAATTACTTCCCTTCAAGGTTGGATCCAGTTCGCCATGCCGAAAAATACCCTACAACTCCTATTGTCTGCTCTGGAAATCGTGAGAAGGTCAGAGTCCTCTACA
TACATTAATTTTTGATCACAAGTTTTATCCTCATAAGTCATAGTTAAAACTCAAATGTCATCTTTATATCACAGTGCTTCATCGGGAAGGAGAACAACTTCAAGCAACCAGGGGAGAGAT
ACCGGTCCTGGGATTCAGACAG
GTAAACACTAAAAACTCAAAAACCACATTGCAAAATCAACAATTACACATGAACCACAAATGTCATAATTCATTCTAATGGTCTTTTGTTTTGTACCA
ATAGGCAAGAACGATTCGTGAAGCGTTTTGTTGAAGCGCTTTCGGAGCCTCGTGTCACGCACGAAATCCGCAGCATTTGGATCTCTTACTGGTCTCAGGCAGACAAATCTCTGGGACAGA
AACTAGCAACTCGTCTTAACGTGAGGCCAAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAGGGTTCGTCCTTCAAGCGCTCATGATTCCCCTTTCTTCACTACAAACTCGGGTGCTCCTGTCTGGAACAACAACTCTTCTTTGACTGTCGGAACTCGAGGTCCAATC
CTTCTGGAGGACTATCATCTGCTTGAGAAACTCGCTAACTTTGACAGGGAGCGGATTCCTGAGAGGGTTGTTCATGCCAGGGGAGCCAGTGCTAAGGGTTTCTTTGAAGTCACTCATGAC
ATTACCCAACTTACTTCTGCTGATTTTCTTCGAGGACCTGGTGTTCAGACTCCTGTTATCGTTCGTTTCTCAACTGTCATCCATGAGCGTGGCAGTCCCGAGACTCTCAGAGATCCCCGT
GGTTTTGCTGTTAAGTTTTACACCAGAGAG
GGGAACTTTGATCTTGTTGGGAACAACTTCCCTGTATTCTTCGTCCGTGATGGAATGAAATTCCCTGACATGGTCCATGCATTGAAACCG
AATCCCAAGTCTCACATTCAGGAGAACTGGAGGATACTGGACTTCTTCTCCCACCACCCAGAGAGTTTGCACATGTTTTCATTTCTCTTTGATGATCTCGGTATCCCACAGGACTACAGG
CACATGGAAGGCGCTGGGGTCAACACTTACATGCTAATCAACAAAGCTGGAAAAGCTCACTATGTGAAATTCCACTGGAAGCCGACTTGTGGGATCAAATGCCTGTCGGATGAGGAAGCT
ATCAGAGTTGGAGGAGCCAATCACAGCCATGCCACCAAAGATCTCTATGACTCGATCGCAGCCGGGAACTATCCGCAGTGGAATCTCTTCGTTCAGGTGATGGATCCTGCCCATGAAGAC
AAATTTGACTTCGATCCGCTTGATGTCACAAAGATCTGGCCTGAAGATATCTTGCCTTTACAACCTGTTGGTCGCTTGGTCTTGAACAAAAACATCGACAACTTCTTTAATGAGAACGAA
CAGATTGCATTCTGTCCTGCTCTTGTGGTTCCAGGCATCCACTATTCAGATGATAAGCTACTCCAGACCCGGATCTTCTCCTACGCTGATAGTCAGAGACACCGTCTTGGACCAAACTAT
CTGCAACTACCTGTTAATGCCCCTAAATGTGCTCACCACAACAATCACCATGATGGTTTTATGAACTTCATGCACAGGGATGAGGAG
GTCAATTACTTCCCTTCAAGGTTGGATCCAGTT
CGCCATGCCGAAAAATACCCTACAACTCCTATTGTCTGCTCTGGAAATCGTGAGAAG
TGCTTCATCGGGAAGGAGAACAACTTCAAGCAACCAGGGGAGAGATACCGGTCCTGGGATTCA
GACAG
GCAAGAACGATTCGTGAAGCGTTTTGTTGAAGCGCTTTCGGAGCCTCGTGTCACGCACGAAATCCGCAGCATTTGGATCTCTTACTGGTCTCAGGCAGACAAATCTCTGGGACAG
AAACTAGCAACTCGTCTTAACGTGAGGCCAAACTTCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACAAAGACA AAACACATAC GTGTTTTGGT GTTGAGCTAA AATAAGATAT TTTGGCTCTC GCTATAAAAA AAAAATCGAC AACAGTGCAG ACACACGCCG ATTTGCGAGA TACACACAGT  CTCACCTAAA AATCGCAAAA GAAGAAAAAT TCGGATCAAA ATTGTCTTCA AGCATCATGG ATCCATACAG GGTTCGTCCT TCAAGCGCTC ATGATTCCCC TTTCTTCACT ACAAACTCGG  GTGCTCCTGT CTGGAACAAC AACTCTTCTT TGACTGTCGG AACTCGAGGT CCAATCCTTC TGGAGGACTA TCATCTGCTT GAGAAACTCG CTAACTTTGA CAGGGAGCGG ATTCCTGAGA  GGGTTGTTCA TGCCAGGGGA GCCAGTGCTA AGGGTTTCTT TGAAGTCACT CATGACATTA CCCAACTTAC TTCTGCTGAT TTTCTTCGAG GACCTGGTGT TCAGACTCCT GTTATCGTTC  GTTTCTCAAC TGTCATCCAT GAGCGTGGCA GTCCCGAGAC TCTCAGAGAT CCCCGTGGTT TTGCTGTTAA GTTTTACACC AGAGAGGGGA ACTTTGATCT TGTTGGGAAC AACTTCCCTG  TATTCTTCGT CCGTGATGGA ATGAAATTCC CTGACATGGT CCATGCATTG AAACCGAATC CCAAGTCTCA CATTCAGGAG AACTGGAGGA TACTGGACTT CTTCTCCCAC CACCCAGAGA  GTTTGCACAT GTTTTCATTT CTCTTTGATG ATCTCGGTAT CCCACAGGAC TACAGGCACA TGGAAGGCGC TGGGGTCAAC ACTTACATGC TAATCAACAA AGCTGGAAAA GCTCACTATG  TGAAATTCCA CTGGAAGCCG ACTTGTGGGA TCAAATGCCT GTCGGATGAG GAAGCTATCA GAGTTGGAGG AGCCAATCAC AGCCATGCCA CCAAAGATCT CTATGACTCG ATCGCAGCCG  GGAACTATCC GCAGTGGAAT CTCTTCGTTC AGGTGATGGA TCCTGCCCAT GAAGACAAAT TTGACTTCGA TCCGCTTGAT GTCACAAAGA TCTGGCCTGA AGATATCTTG CCTTTACAAC  CTGTTGGTCG CTTGGTCTTG AACAAAAACA TCGACAACTT CTTTAATGAG AACGAACAGA TTGCATTCTG TCCTGCTCTT GTGGTTCCAG GCATCCACTA TTCAGATGAT AAGCTACTCC  AGACCCGGAT CTTCTCCTAC GCTGATAGTC AGAGACACCG TCTTGGACCA AACTATCTGC AACTACCTGT TAATGCCCCT AAATGTGCTC ACCACAACAA TCACCATGAT GGTTTTATGA  ACTTCATGCA CAGGGATGAG GAGGTCAATT ACTTCCCTTC AAGGTTGGAT CCAGTTCGCC ATGCCGAAAA ATACCCTACA ACTCCTATTG TCTGCTCTGG AAATCGTGAG AAGTGCTTCA  TCGGGAAGGA GAACAACTTC AAGCAACCAG GGGAGAGATA CCGGTCCTGG GATTCAGACA GGCAAGAACG ATTCGTGAAG CGTTTTGTTG AAGCGCTTTC GGAGCCTCGT GTCACGCACG  AAATCCGCAG CATTTGGATC TCTTACTGGT CTCAGGCAGA CAAATCTCTG GGACAGAAAC TAGCAACTCG TCTTAACGTG AGGCCAAACT TCTGAATGAT ATCATCTCTA AAGACTAAGT  GAAATCCTAT AAACTCAATA TGCTCCTCTT ACGGTTTGGT TTCTAAGTAA TCTCGTTTAT TGACAATGAA ACGCTTAAAG AAGGGTACTA GTTCCTGTTT GTAATCTTCT TTTCAAAATA  TTAACGATTA TTTTCTAAGG CAAATAAATA AAAAGCTATG ACTAATATAG CTTAGTAAAC AAGTATCACT ATCATCCATT TGGTTCTACT TTAAAAATGG ATTTTTATTT GTATTTTAAT 
CTTCTGCATC TATGACGTGA GCTTATAGTT GGAATTTTAT TGGGGTCTAA TGTCAGACGC ACGATCTTGA TAAAAAAGTT TTATGTCTGT CCATATTTTG ATA 

Retrieve as FASTA