Entry information : AtKat03 (CAT3 / At1g20620)
Entry ID 5143
Creation 2007-04-06 (Christophe Dunand)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtKat03 (CAT3 / At1g20620)
Name (synonym) AtKat03 (CAT3 / At1g20620)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtKat03
start..stop
S start..stop
AlyKat03 1024 0 1..492 1..492
BnKat03_other 1018 0 1..492 1..492
ThasKat05 854 0 1..492 1..492
ThasKat04 853 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7143142..7143156 15 N° 2 7144207..7144303 97 N° 3 7144459..7144736 278 N° 4 7144829..7145605 777
N° 5 7145691..7145780 90 N° 6 7145880..7146041 162 N° 7 7146134..7146193 60  
join(7143142..7143156,7144207..7144303,7144459..7144736,7144829..7145605,7145691 ..7145780,7145880..7146041,7146134..7146193)


exon

Literature and cross-references AtKat03 (CAT3 / At1g20620)
Literature Frugoli J.A., McPeek M.A., Thomas T.L., McClung C.R. Intron loss and gain during evolution of the catalase gene family in angiosperms. Genetics 149:355-365(1998).
Protein ref. UniProtKB:   Q42547
DNA ref. Phytozome 11:   Chr1 (7143142..7146193)
Cluster/Prediction ref. Phytozome Gene 11:   19653073 UniGene:   At.24821
Omic ref. AtProteome:   At1g20620 ATTED-II:   At1g20620 e-FP Browser:   At1g20620 Genevestigator:   At1g20620 TAIR:   At1g20620
Protein sequence: AtKat03 (CAT3 / At1g20620)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56546.48  
PI (pH):   %s   7.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSAYNAPFYTTNGGAPVSNNISSLTIGERGPVLLEDYHLIEKVANFTRERIPERVVHARGISAKGFFEVTHDISNLTCADFLRAPGVQTPVIVRFSTVVHERASPETMRDIRGFAVKFYTRGNFDLVGNNTPVFFIRDGIQFPDVVHALKPNPKTNIQEYWRILDYMSHLPESLLTWCWMFDDVGIPQDYRHMEGFGVHTYTLIAKSGKVLFVKFHWKPTCGIKNLTDEEAKVVGGANHSHATKDLHDAIASGNYPEWKLFIQTMDPADEDKFDFDPLDVTKIWPEDILPLQPVGRLVLNRTIDNFFNETEQLAFNPGLVVPGIYYSDDKLLQCRIFAYGDTQRHRLGPNYLQLPVNAPKCAHHNNHHEGFMNFMHRDEEINYYPSKFDPVRCAEKVPTPTNSYTGIRTKCVIKKENNFKQAGDRYRSWAPDRQDRFVKRWVEILSEPRLTHEIRGIWISYWSQADRSLGQKLASRLNVRPSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns), 10 cDNA and 1958 ESTs. Three SwissProt/TREMBL accessions: Q42547, Q2V4M3 and Q2V4M4. Cultivar="Landsberg erecta" and "Columbia".
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGCTTCTGG CATTTTTTGA CTTTTGTCGT CACTAAACGA AGAGACTTGA CCGTGGTAAG ACGATTTCAA CAACTTTATC TGATAAGGGG ACTATGATAT TTTGTGTCAA AAAAAAACGG  GGGCTATGAT ATTTTTTACA TAGCTACAAT TTCTTTTTCT TTTTTTGGGG TGAATCTAGA TATCAGGCTT GGGTTCATTA TTACTTCAGG TTTAGGATTA ATATTGGATA GCATATATAT  CCTCTAATTT GTAATTAACT CAACATTTGA TAACACGAAG ATATATTCTG TGATTTGAAA TTATCTATCA TCAAAAATGG AGCCAATAAC TTTGAAACAA CACGTTTTAC CAGTGATAGT  AACACCACAT TTGGTTATGT CATATGTGCT CCACGTGATG TGGTCCATGT GGATACAAAA TAACACACAC ACAAAAAACT GCATTTGAGT TATTTTAGTC ATTGCACTTA ATATATATGC  GGCATACTGG AGAGGATTAA AAGTCCTAAT AACTCTAAAT GTCTAAATTA TAAACAAGTA AATTTATAAC TACGAGAGTA TCTCCCTACT CCACTTTTAT CTCTTATAGC TTATTGGATT  GTTGTTTTCG TAACAGAGCT ACTACAATGT TTATGGAGGG GGGCAACTGC GCAATATGTC CTTTAAAGAA ATATATAAAA GAATGCGAAA TGAATTCTGT TAAACGGAGA TAGATGAAGA  TTGTCTTCTA ATGATTGCCA CTTTCTGAGA ATAGTATGTT ACTGTTGATT GTTGTACCTA GCTCTAGTTG TAAATAATAA TATCAAACTA AGTAACAAGA GCAACTTGTT GACACTAAAG  GGACCCCAAG TTACCCTCAA TCAAAAATTG TGGATCAGTT CATCATCGAA GTAACGTGTT AATTATCGTC ATATGCTCCA CAACATCGAC TCCCCACCAT ACCCACTCAA TAATGTCAAT  TCAGCTCTCT CTTTTTGTAT TTTTATAAAG AATGTATTTA AATTTTCAAC CCATAATTTA TAGATTCATG ATCATCTATT AATAATTCAT TAAATACTTT TCTGCATATT GATTTATTTA  AAAGCCGTAC GCAAGCTCAA ATCGGATAAG ACTAAAATAA TATCACCCAG TTAAGTTAAC TAACTTATTT TATTTTGAAT AGTAGTATTA ATTACTTTTG TTCAACTACT CCAATACTGT  TTATATCCTT TCGACGGTAT TAGTTATTTT CATGTTTCAC GCATTTTTGT AATTGCAAAT ACAGACACCT TTGTTGTAAC ACATGTTGAT TAATTTTCCG AAACTATATA CTTTTGAAGA  CAAAAATTTA AAACAAAGAA ACCTCAGATC TACAGTTCCA CCTCGTGTCT GACACGAGTT TCTATGCGAT AAGATCGAAC ATGTATATCA GCAGACTTTA CTATAGATGA ACTCATATTA  GTAATAAGAT CCAAATACGG AAATAAACAA CTTGGAAAGT GAATGGAAGT TTTAAGAGAA AAATCATTTC TAGAATTATT TTTTAGATCA TTTCTTTTTT TGGAGCATCC ATTAGAGTTT  TGTTTTTAGA CTTTATGATT TATTTTTCTT TTGTTATCAG CACAATAATT GATTTTCAAA AGATATTGTA TCTTTTTTTT ATCTCTTGAG AAGCACAGCA CAACAACGAG CAATGCTGAC  TTGTCGGGGT CAGCGATTAT TATTAGTCAC CGAACGAATT TTTCTTGGGT TGGAGCCAAA ACCTAGCAAA AAAATATCTA AGTGGGGGCA CTACATTATT GTTTTAACAC CAAGGAAAAG  TAAACAACAA TGGCCCATTT TTACTGTATC GAGAAATTGA TCTCGAAAGG ACAAATGTAC CCTTCCACTT CGGGAATCCA TTATTGTGCA TAACACACGC TGTTTCACTA TATATACTTT 
CACATAGGAT CTCAACACTC TCACTAAACC AAAATCCTCA AAAGCCTATT TGGGGGATCA TCAACCTTCT ATCATCACC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGCCAATCT CCATATAAGC TCAGTCTATG TGAGGTACAA TCAATCTCAT CGATCTATCA TCGCTTGGTC GTTAAATCCG TCAAAAAGAT AATCACATGT GTTGTTGTTT CTTGTCTATA  TAATAATAAT GCTTGTAATC CCAAAAACTC ATGTTTCCTT CCTTTCTACT CTCACTGTCT TTGTAATCTC TTTTTACAAT AAATCAATGT TTCTTGAAGC AGTAAACAAT TTCTAAGATT  TATGGTGGTC GTTATACATA TTATTAATTC AGGAAAAAAA AGAGAAGATA CCGTAATTGA ACATGTATTA TTTTAAGGAG AATCCTGAAA TGGATCAACA ATTGTCTAAT TATGGTATAG  TATCTGGCGA AATCAAAGAC GATATCATCC ACACGTAATT AGTTTGACTA TTAATACGAG GATTATCATT TGGATAAGGA TTAACAAAGA CAAAACACAT ACGTGTTTTG GTGTTGAGCT  AAAATAAGAT ATTTTGGCTC TCGCTATAAA AAAAAAATCG ACAACAGTGC AGACACACGC CGATTTGCGA GATACACACA GTCTCACCTA AAAATCGCAA AAGAAGAAAA ATTCGGATCA  AAATTGTCTT CAAGCATCAT GGATCCATAC AGGGTACATC GATTGATTCT CTTTTTTTGT AATCTGTGAT TTTACCTTAC TTGATTTCGT ATCGATTTGG TGTGATTTCG TGTTGAATCC  AAAGTGTATG AATGATCTCT CTCTCTCGGT TAAAATGATG CAAAATTGGG GTGATTGTTC GACTTGTTGA GGTTTTTTTG TGTGAATCGA TTTCTTTATT ATATAGTGGA GATTGGGTTT  CGATTTGCAT GCGTTGAAGA TTCCACTGGA AAATTCAACA TGTTTTTCCG TCTATTGATT GTTTATTTGT CAACATGCTC ATGCTCATGC TCATGTTCTA ATACACAAGT CTTAAGGCTG 
ACGTGATCTG TCAATATCGT TGTACATGTT TTAAGGTTT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTATCTTCGATCATATTCTTCTTACTTTTTCTTTGTTTTTGTGTGGTGTATGTGTATCTTAATTAGAATTAGGTTCAACTATATATGCTCGTTTTCTAAACTATT
TTTTAATTGGATTGATGTTCTTAAATCTTAAGGGTCAAAATACTTTTTATGCTCAAAAACTTACTTAAATTCTGTGATCGCTTGAACCTAAGTTGATGATGTTGATTTCTGTTTTGGCTG
GCTATCTTTAATTAAAACGTTTAACCACTGCGTGAGAAAGACACGCCACATGTGGTTTTTGTTGTTTTTTTCCTTAGATTAGAAGTTATTTTGTTGTTGTTTTTTTTTTTATTATTATTA
CACACATGTGTTCTAAAAATCGGACGTTCAAATGATATAATCGATTGTTTAGACGTCCGACCGTATATTATTTTAGTGATATCAGCCAAATCAGATTAAGTAATCATCAACAAAATGATT
GATCAGATCTACTAAACACCTGAGTAATCAAATCTACACGTTTGATTAATCAAATTAAATAACCGATCAGTTAGATCTATACATATGATAAATCTTTTTTTACAACATTCGGTTAATCAA
ACCATTGTCGGTCGATCTATCAATACAAGTGTATTTTTTTTTCACATACAAAAAAATTATCTCACCGACGAAAAAAAAATAAAAAATTATTATGTAGATCCATCGAACAAAAGGCTTGAA
TATACGGAAGTCACTTAAAAGTGTAATAATCGAATAAATATTAGTGGATAAAATGAAATTTATCTACAACCCTACTCTCCGACATGTTACTGTTTGCGTCATCAAATCTAAAGCCTTTTT
GGCAAATAATGGTCGGAAGACTACTCGTGTCGGGATGGACCACCCGGATCCGATCAGGAAACGGGTTTTGATATGTTTCGGGTTACGACAAAAAATTAGGGCTTTTTATCAAATCAATCA
GTTGGTAGTAAAATTTTGTGGATTGTTCTTGTCGATTCCGTTTGATTGTTGACCAAATTTCTTCCTGGATTTTGTTGATAATCGATCGTATAATGGTGATTGCAGTATCGTCCTTCAAGC
GCGTACAACGCCCCATTCTACACCACAAACGGTGGTGCTCCAGTCTCCAACAACATCTCTTCCCTCACCATCGGAGAAAGAG
GTATCGTAACCCTGAATTTCAAGAGTCTATCAATAAGA
ATCGGAACTTGTTGGATTTATGAAAGAGATAAAACTGAGATATAGAGTCTAAGCTGAGATCTTGTTCGTGAAGCGTGATGTGATTATTTTTAACATGTGTTACTTCGTAATGGGCAGGTC
CGGTTCTTCTTGAGGATTATCATTTGATCGAGAAGGTTGCTAATTTCACCAGAGAGAGGATCCCTGAGAGAGTGGTTCATGCTAGAGGAATCAGTGCTAAGGGTTTCTTTGAAGTCACCC
ATGACATTTCAAACCTCACTTGTGCTGATTTTCTCAGAGCCCCTGGTGTTCAAACTCCGGTTATTGTCCGTTTCTCCACCGTTGTCCACGAACGTGCCAGTCCTGAAACCATGAGGGATA
TTCGTGGTTTTGCTGTCAAGTTTTACACCAGAGAG
GTATAAGAAAAGATTCAAAGTTTCCATTTTTAATCGTCTTTTAGCTTCTTTAGAATCAGGACTGATTTTTGTCTTGTTACTGTTA
TGATCAGGGAAACTTTGATCTTGTTGGGAACAACACTCCGGTGTTCTTCATCCGTGATGGGATTCAGTTCCCGGATGTTGTCCACGCGTTGAAACCTAACCCGAAAACAAACATCCAAGA
GTACTGGAGGATTCTGGACTACATGTCCCACTTGCCTGAGAGTTTGCTCACATGGTGCTGGATGTTTGATGATGTTGGTATTCCACAAGATTACAGGCACATGGAGGGTTTCGGTGTCCA
CACCTACACTCTTATTGCCAAATCTGGAAAAGTTCTCTTTGTGAAGTTCCACTGGAAACCAACTTGTGGGATCAAGAATCTGACTGATGAAGAGGCCAAGGTTGTTGGAGGAGCCAATCA
CAGCCACGCCACTAAGGATCTCCACGATGCCATTGCATCTGGCAACTACCCCGAGTGGAAACTTTTCATCCAGACCATGGATCCTGCAGATGAGGATAAGTTTGACTTTGACCCACTTGA
TGTGACCAAGATCTGGCCTGAGGATATTTTGCCTCTGCAACCGGTTGGTCGCTTGGTTCTGAACAGGACCATTGACAATTTCTTCAATGAAACTGAGCAGCTTGCGTTCAACCCGGGTCT
TGTGGTTCCTGGAATCTACTACTCAGACGACAAGCTGCTCCAGTGTAGGATCTTTGCTTATGGTGACACTCAGAGACATCGCCTTGGACCGAATTATTTGCAGCTTCCAGTCAATGCTCC
CAAATGTGCTCACCACAACAATCACCATGAAGGTTTTATGAACTTCATGCACAGAGATGAGGAG
GTACGTCTTAGTACACCACTTGAGCTACCATTGTTAGTCTTTTTACTTGGAATCAA
AATTCTCATTTGGTTTGTACTTTTTACAGATCAATTACTACCCCTCAAAGTTTGATCCTGTCCGCTGCGCTGAGAAAGTTCCCACCCCTACAAACTCCTACACTGGAATTCGAACAAAGG
TCCGATTCCTGCCATGCCTTCTCTAAATCTTCAAATCCTAAACTCAAGTTTATTAGAATATTGGTGCTAAGAAAACCTTTTAATTGCTAATGTTGCAGTGCGTCATCAAGAAAGAGAACA
ACTTCAAACAGGCTGGAGACAGGTACAGATCATGGGCACCAGACAGGCAAGACAGGTTTGTTAAGAGATGGGTGGAGATTCTATCGGAGCCACGTCTCACCCACGAGATCCGCGGCATCT
GGATCTCTTACTGGTCTCAG
GTCAGAACAAAAAAACACTCGGTCAAATTTCTACGTCCTTTTTACCAAGTTTCAGCAAACTAAAACATTATTTATCTCTCTGTATCTCTCAGGCTGATCG
ATCCTTGGGACAGAAACTTGCAAGCCGTCTGAACGTGAGGCCAAGCATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGTATCGTCCTTCAAGCGCGTACAACGCCCCATTCTACACCACAAACGGTGGTGCTCCAGTCTCCAACAACATCTCTTCCCTCACCATCGGAGAAAGAGGTCCGGTT
CTTCTTGAGGATTATCATTTGATCGAGAAGGTTGCTAATTTCACCAGAGAGAGGATCCCTGAGAGAGTGGTTCATGCTAGAGGAATCAGTGCTAAGGGTTTCTTTGAAGTCACCCATGAC
ATTTCAAACCTCACTTGTGCTGATTTTCTCAGAGCCCCTGGTGTTCAAACTCCGGTTATTGTCCGTTTCTCCACCGTTGTCCACGAACGTGCCAGTCCTGAAACCATGAGGGATATTCGT
GGTTTTGCTGTCAAGTTTTACACCAGAGAG
GGAAACTTTGATCTTGTTGGGAACAACACTCCGGTGTTCTTCATCCGTGATGGGATTCAGTTCCCGGATGTTGTCCACGCGTTGAAACCT
AACCCGAAAACAAACATCCAAGAGTACTGGAGGATTCTGGACTACATGTCCCACTTGCCTGAGAGTTTGCTCACATGGTGCTGGATGTTTGATGATGTTGGTATTCCACAAGATTACAGG
CACATGGAGGGTTTCGGTGTCCACACCTACACTCTTATTGCCAAATCTGGAAAAGTTCTCTTTGTGAAGTTCCACTGGAAACCAACTTGTGGGATCAAGAATCTGACTGATGAAGAGGCC
AAGGTTGTTGGAGGAGCCAATCACAGCCACGCCACTAAGGATCTCCACGATGCCATTGCATCTGGCAACTACCCCGAGTGGAAACTTTTCATCCAGACCATGGATCCTGCAGATGAGGAT
AAGTTTGACTTTGACCCACTTGATGTGACCAAGATCTGGCCTGAGGATATTTTGCCTCTGCAACCGGTTGGTCGCTTGGTTCTGAACAGGACCATTGACAATTTCTTCAATGAAACTGAG
CAGCTTGCGTTCAACCCGGGTCTTGTGGTTCCTGGAATCTACTACTCAGACGACAAGCTGCTCCAGTGTAGGATCTTTGCTTATGGTGACACTCAGAGACATCGCCTTGGACCGAATTAT
TTGCAGCTTCCAGTCAATGCTCCCAAATGTGCTCACCACAACAATCACCATGAAGGTTTTATGAACTTCATGCACAGAGATGAGGAG
ATCAATTACTACCCCTCAAAGTTTGATCCTGTC
CGCTGCGCTGAGAAAGTTCCCACCCCTACAAACTCCTACACTGGAATTCGAACAAAG
TGCGTCATCAAGAAAGAGAACAACTTCAAACAGGCTGGAGACAGGTACAGATCATGGGCACCA
GACAGGCAAGACAGGTTTGTTAAGAGATGGGTGGAGATTCTATCGGAGCCACGTCTCACCCACGAGATCCGCGGCATCTGGATCTCTTACTGGTCTCAG
GCTGATCGATCCTTGGGACAG
AAACTTGCAAGCCGTCTGAACGTGAGGCCAAGCATCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAGGATCTCA ACACTCTCAC TAAACCAAAA TCCTCAAAAG CCTATTTGGG GGATCATCAA CCTTCTATCA TCACCATGGA TCCTTACAAG TATCGTCCTT CAAGCGCGTA CAACGCCCCA  TTCTACACCA CAAACGGTGG TGCTCCAGTC TCCAACAACA TCTCTTCCCT CACCATCGGA GAAAGAGGTC CGGTTCTTCT TGAGGATTAT CATTTGATCG AGAAGGTTGC TAATTTCACC  AGAGAGAGGA TCCCTGAGAG AGTGGTTCAT GCTAGAGGAA TCAGTGCTAA GGGTTTCTTT GAAGTCACCC ATGACATTTC AAACCTCACT TGTGCTGATT TTCTCAGAGC CCCTGGTGTT  CAAACTCCGG TTATTGTCCG TTTCTCCACC GTTGTCCACG AACGTGCCAG TCCTGAAACC ATGAGGGATA TTCGTGGTTT TGCTGTCAAG TTTTACACCA GAGAGGGAAA CTTTGATCTT  GTTGGGAACA ACACTCCGGT GTTCTTCATC CGTGATGGGA TTCAGTTCCC GGATGTTGTC CACGCGTTGA AACCTAACCC GAAAACAAAC ATCCAAGAGT ACTGGAGGAT TCTGGACTAC  ATGTCCCACT TGCCTGAGAG TTTGCTCACA TGGTGCTGGA TGTTTGATGA TGTTGGTATT CCACAAGATT ACAGGCACAT GGAGGGTTTC GGTGTCCACA CCTACACTCT TATTGCCAAA  TCTGGAAAAG TTCTCTTTGT GAAGTTCCAC TGGAAACCAA CTTGTGGGAT CAAGAATCTG ACTGATGAAG AGGCCAAGGT TGTTGGAGGA GCCAATCACA GCCACGCCAC TAAGGATCTC  CACGATGCCA TTGCATCTGG CAACTACCCC GAGTGGAAAC TTTTCATCCA GACCATGGAT CCTGCAGATG AGGATAAGTT TGACTTTGAC CCACTTGATG TGACCAAGAT CTGGCCTGAG  GATATTTTGC CTCTGCAACC GGTTGGTCGC TTGGTTCTGA ACAGGACCAT TGACAATTTC TTCAATGAAA CTGAGCAGCT TGCGTTCAAC CCGGGTCTTG TGGTTCCTGG AATCTACTAC  TCAGACGACA AGCTGCTCCA GTGTAGGATC TTTGCTTATG GTGACACTCA GAGACATCGC CTTGGACCGA ATTATTTGCA GCTTCCAGTC AATGCTCCCA AATGTGCTCA CCACAACAAT  CACCATGAAG GTTTTATGAA CTTCATGCAC AGAGATGAGG AGATCAATTA CTACCCCTCA AAGTTTGATC CTGTCCGCTG CGCTGAGAAA GTTCCCACCC CTACAAACTC CTACACTGGA  ATTCGAACAA AGTGCGTCAT CAAGAAAGAG AACAACTTCA AACAGGCTGG AGACAGGTAC AGATCATGGG CACCAGACAG GCAAGACAGG TTTGTTAAGA GATGGGTGGA GATTCTATCG  GAGCCACGTC TCACCCACGA GATCCGCGGC ATCTGGATCT CTTACTGGTC TCAGGCTGAT CGATCCTTGG GACAGAAACT TGCAAGCCGT CTGAACGTGA GGCCAAGCAT CTAGAGGCCA  ATCTCCATAT AAGCTCAGTC TATGTGAGGT ACAATCAATC TCATCGATCT ATCATCGCTT GGTCGTTAAA TCCGTCAAAA AGATAATCAC ATGTGTTGTT GTTTCTTGTC TATATAATAA  TAATGCTTGT AATCCCAAAA ACTCATGTTT CCTTCCTTTC TACTCTCACT GTCTTTGTAA TCTCTTTTTA CAATAAATCA ATGTTTCTTG AAGCAGTAAA CAATTTCTAA GATTTATGGT 
GGTCGTTATA CATATTATTA ATTCAGGAAA AAAAAGAGAA GATACCGTAA TTGAACATGT ATTATTTTAA GGAGAATCCT GAAATGGATC AACAATTGTC T 

Retrieve as FASTA