Entry information : OsKat03 (CatC / Cat1 / OS03G03910)
Entry ID 5144
Creation 2010-01-27 (Christophe Dunand)
Last sequence changes 2010-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsKat03 (CatC / Cat1 / OS03G03910)
Name (synonym) OsKat03 (CatC / Cat1 / OS03G03910)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Inflorescences
Leaves
Mixed tissues
Roots
Seeds
Stems
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsKat03
start..stop
S start..stop
SbKat02 961 0 1..492 1..492
VvKat02 928 0 1..492 1..492
LuKat 927 0 1..492 1..492
GhKat01 926 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1770265..1770279 15 N° 2 1770072..1770168 97 N° 3 1768441..1769585 1145 N° 4 1768004..1768071 68
N° 5 1767798..1767891 94 N° 6 1767617..1767676 60  
complement(join(1767617..1767676,1767798..1767891,1768004..1768071,1768441..1769 585,1770072..1770168,1770265..1770279))


exon

Literature and cross-references OsKat03 (CatC / Cat1 / OS03G03910)
Literature Kim,S., Park,S. and Lee,Y. Cloning and expression of a new rice catalase gene.
Protein ref. UniProtKB:   Q10S82   Q10S81 [Fragment] UniProtKB_Uniparc:   A2XC35 [Different splicing]   Q8LSP8 [Different splicing]
DNA ref. GenBank:   NC_008396.1 (1770279..1767620)
Cluster/Prediction ref. UniGene:   Os.7986
Protein sequence: OsKat03 (CatC / Cat1 / OS03G03910)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56597.26  
PI (pH):   %s   7.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSSFNGPLWSTNSGAPVWNNNNSLTVGSRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDITHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAIKFYTREGNWDLVGNNFPVFFIRDGMKFPDMVHSLKPNPKSHVQENWRILDFFSHHPESLHMFTFLFDDIGIPADYRHMDGSGVNTYTLVNRAGKSHYVKFHWKPTCGVKSLLDDEAVTVGGTNHSHATQDLYDSIAAGNFPEWKLFIQTIDPDHEDRFDFDPLDVTKTWPEDIVPLQPVGRMVLNRNIDNFFSENEQLAFCPGIIVPGIYYSDDKLLQTRIFSYSDTQRHRLGPNYLLLPPNAPKCAHHNNHYDGFMNFMHRDEEVDYFPSRYDPAKHAPRYPIPSATLTGRREVVIAKENNFKQPGERYRSWDPARQDRFIKRWIDALSDPRLTHEIRSIWLSYWSADRSLGQKLASRLSAKPSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 5 introns, 6 cDNA and 446 ESTs. cultivar="Nipponbare". Two other SwissProt/TREMBL accessions: Q8LSP8 and A2XC35 (both contain a C-Term extension due to an alternative splicing prediction NOT YET confirmed with EST).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGGTAACGAACGTGCTCTGCTCTGCTTCTGGGGCGAGGGGTTTGAGAGTGCGTTGGTTTTTTGTGGTTTTGATGCGGAATTTGGTGTGATGCGCGCAGCACCGCCCG
TCGAGCTCGTTCAACGGCCCGCTGTGGAGCACCAACTCCGGCGCCCCCGTATGGAACAACAACAACTCGCTCACCGTCGGCTCCCGAG
GTACGTATGACCACGCCAATCCCCCTTCCTCC
TGTGGTTTGAGATTACTTTTTGTGTCTTCTGTGGTGTAGCCTTTGCTGCTACCAGTTTAAATTCAAGAACGTCATCCCAGTAAATCTGTGCTAGTCTGGATTCATTTGTTTTTTTTCCTA
AAAAATACTTTGATAGTATTTGGTTACAACTTATAACACCATGTCCAGAAGATTAGAACCTGTTGTGTTTTCAAGCTACAGGCGGAATCATTTGAAAATTGAATTGTTTCCTAGTTCCTC
CTACAAATTGAAACTGTTGCGTTTGTTAGAGCACATGAATTTCATACGATTCTGTACATCTCAGCTAGGTCCAGACTCCGTGGGGAGCAATTCACTACAGTAAATTAGTACTAATTACGA
TTTTACGATAGTGTTCCGTAGCATGTTTGTCAGTTTAATTCAAGTCGAGTGGTGATCGATGAACTGAACTGAACTGGGAACACTGAAAATTCAGGCCCGATCCTTCTGGAGGACTACCAC
CTGGTTGAGAAGCTGGCCAACTTCGACAGGGAGCGTATCCCGGAGCGCGTGGTGCACGCCCGCGGCGCCAGCGCCAAGGGCTTCTTCGAGGTCACCCACGACATCACCCACCTCACCTGC
GCCGACTTCCTCCGCGCCCCGGGCGTCCAGACCCCGGTCATCGTCCGCTTCTCCACCGTCATCCACGAGCGCGGCAGCCCGGAGACCCTCCGCGACCCGCGTGGCTTCGCCATCAAGTTC
TACACCCGGGAGGGCAACTGGGACCTCGTCGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATGAAGTTCCCGGACATGGTGCACTCGCTCAAGCCCAACCCCAAGTCGCACGTC
CAGGAGAACTGGCGCATCCTCGACTTCTTCTCCCACCACCCGGAGAGCCTCCACATGTTCACCTTCCTCTTCGATGACATCGGCATCCCCGCCGACTACCGCCACATGGACGGCTCCGGC
GTCAACACCTACACGCTCGTCAACCGCGCCGGCAAGTCGCACTACGTCAAGTTCCACTGGAAGCCCACCTGCGGCGTCAAGTCGCTGCTCGACGACGAGGCCGTCACCGTCGGCGGGACC
AACCACAGCCACGCCACGCAGGACCTCTACGACTCCATCGCCGCCGGCAACTTCCCGGAGTGGAAGCTGTTCATCCAGACCATCGACCCCGACCACGAGGACCGCTTCGACTTCGACCCG
CTCGACGTCACCAAGACGTGGCCCGAGGACATCGTCCCGCTGCAGCCCGTGGGGAGGATGGTGCTCAACCGCAACATCGACAACTTCTTCTCGGAGAACGAGCAGCTGGCGTTCTGCCCC
GGGATCATCGTGCCGGGGATCTACTACTCCGACGACAAGCTGCTGCAGACGAGGATCTTCTCCTACTCCGACACGCAGCGCCACCGCCTCGGACCAAACTACCTGCTGCTCCCGCCCAAC
GCGCCCAAGTGCGCCCACCACAACAACCACTACGACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTCGACTACTTCCCATCCCGCTACGATCCTGCCAAGCACGCCCCCCGCTAC
CCCATCCCCTCCGCCACCCTCACCGGCCGCCGCGAGAAG
GTAATTCTGTTGATTGATTTGCGTTTGGGTTTTACATTTCACTATATTTTCTTTCTTAATTACTACTTCCCCCGTTTCAGA
TTATAAGATGTTTTAATTTTAGTCAATCTCAAACTATAAGTTTAACTAAGTTTATAGATAAATATAGTAATAATTACAACACCAAATTAGTTTCATTAAATCATTAAATCTATAGTTCAA
TATATTTATTATGAGTTAAAAATGTTACTATTTTTTATATAAACTTAGTCAAATTTAAAACAGTTTAATTTTGACCAAAGTTAAAACGATTTATAATCTAAAACAGGAGAAGTAGTAATA
GCTAGTCAATTTATTAACTGGTTTTGATCGATCGGGTTGCGAGTGCAGGTGGTGATTGCCAAGGAGAACAACTTCAAGCAGCCAGGGGAGAGGTACCGTTCATGGGATCCGGCAAGGTAT
GTACACACATGCAGATGCAGCAACCGAATTAACTGTCGAGAGACTGAACTAAACTGAATTAGTCAACTAGACTGATTGACTGATGAACAAATGCTAAATGCACTGCAGGCAAGACCGGTT
CATCAAGAGATGGATCGACGCACTCTCTGACCCTCGCCTCACCCACGAGATCAGGAGCATCTGGCTCTCCTACTGGTCTCAG
GTAAATACATCACATTACAGTTTGTTCCATAAATTGAA
AAAAAAACGTACAACATGATCTGTATAATCTGTTCTTGGTTCTGAACTGCAACTTGAACAATCTACTATGTCTTTCGATGCAGGCTGACAGGTCTCTGGGTCAGAAACTGGCGAGCCGTC
TCAGCGCGAAGCCGAGCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGCACCGCCCGTCGAGCTCGTTCAACGGCCCGCTGTGGAGCACCAACTCCGGCGCCCCCGTATGGAACAACAACAACTCGCTCACCGTCGGCTCCCGAGGCCCGATC
CTTCTGGAGGACTACCACCTGGTTGAGAAGCTGGCCAACTTCGACAGGGAGCGTATCCCGGAGCGCGTGGTGCACGCCCGCGGCGCCAGCGCCAAGGGCTTCTTCGAGGTCACCCACGAC
ATCACCCACCTCACCTGCGCCGACTTCCTCCGCGCCCCGGGCGTCCAGACCCCGGTCATCGTCCGCTTCTCCACCGTCATCCACGAGCGCGGCAGCCCGGAGACCCTCCGCGACCCGCGT
GGCTTCGCCATCAAGTTCTACACCCGGGAGGGCAACTGGGACCTCGTCGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATGAAGTTCCCGGACATGGTGCACTCGCTCAAGCCC
AACCCCAAGTCGCACGTCCAGGAGAACTGGCGCATCCTCGACTTCTTCTCCCACCACCCGGAGAGCCTCCACATGTTCACCTTCCTCTTCGATGACATCGGCATCCCCGCCGACTACCGC
CACATGGACGGCTCCGGCGTCAACACCTACACGCTCGTCAACCGCGCCGGCAAGTCGCACTACGTCAAGTTCCACTGGAAGCCCACCTGCGGCGTCAAGTCGCTGCTCGACGACGAGGCC
GTCACCGTCGGCGGGACCAACCACAGCCACGCCACGCAGGACCTCTACGACTCCATCGCCGCCGGCAACTTCCCGGAGTGGAAGCTGTTCATCCAGACCATCGACCCCGACCACGAGGAC
CGCTTCGACTTCGACCCGCTCGACGTCACCAAGACGTGGCCCGAGGACATCGTCCCGCTGCAGCCCGTGGGGAGGATGGTGCTCAACCGCAACATCGACAACTTCTTCTCGGAGAACGAG
CAGCTGGCGTTCTGCCCCGGGATCATCGTGCCGGGGATCTACTACTCCGACGACAAGCTGCTGCAGACGAGGATCTTCTCCTACTCCGACACGCAGCGCCACCGCCTCGGACCAAACTAC
CTGCTGCTCCCGCCCAACGCGCCCAAGTGCGCCCACCACAACAACCACTACGACGGCTTCATGAACTTCATGCACCGCGACGAGGAGGTCGACTACTTCCCATCCCGCTACGATCCTGCC
AAGCACGCCCCCCGCTACCCCATCCCCTCCGCCACCCTCACCGGCCGCCGCGAGAAG
GTGGTGATTGCCAAGGAGAACAACTTCAAGCAGCCAGGGGAGAGGTACCGTTCATGGGATCCG
GCAAG
GCAAGACCGGTTCATCAAGAGATGGATCGACGCACTCTCTGACCCTCGCCTCACCCACGAGATCAGGAGCATCTGGCTCTCCTACTGGTCTCAGGCTGACAGGTCTCTGGGTCAG
AAACTGGCGAGCCGTCTCAGCGCGAAGCCGAGCATGTAA

Retrieve as FASTA