Entry information : OsKat02 (CAT-B / CatB)
Entry ID 5145
Creation 2007-04-08 (Christophe Dunand)
Last sequence changes 2010-08-03 (Marie Brette (Scipio))
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsKat02 (CAT-B / CatB)
Name (synonym) OsKat02 (CAT-B / CatB)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Flowers
Inflorescences
Leaves
Roots
Stems
Vegetative tissues
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsKat02
start..stop
S start..stop
ZmKat1 991 0 1..492 1..492
SbKat03 987 0 1..492 1..492
ZaKat01 906 0 1..492 1..492
VvKat02 906 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30428488..30428502 15 N° 2 30428619..30428715 97 N° 3 30429627..30429904 278 N° 4 30430256..30431032 777
N° 5 30431254..30431343 90 N° 6 30431538..30431605 68 N° 7 30431696..30431789 94 N° 8 30431902..30431961 60
join(30428488..30428502,30428619..30428715,30429627..30429904,30430256..30431032 ,30431254..30431343,30431538..30431605,30431696..30431789,30431902..30431961)


exon

Literature and cross-references OsKat02 (CAT-B / CatB)
Literature REFERENCE 1; Morita S., Tasaka M., Fujisawa H., Ushimaru T., Tsuji H. A cDNA clone encoding a rice catalase isozyme. Plant Physiol. 105:1015-1016(1994).
REFERENCE 2; Iwamoto,M., Maekawa,M., Saito,A., Higo,H. and Higo,K. Evolutionary relationship of plant catalase genes inferred from exon-intron structures: isozyme divergence after the separation of monocots and dicots. Theor. Appl. Genet. 97, 9-19 (1998)
Protein ref. UniProtKB:   Q0D9C4   A2YH64 [Mismatch]
DNA ref. GenBank:   NC_008399.1 (30428488..30431958)
Cluster/Prediction ref. UniGene:   Os.39055
Protein sequence: OsKat02 (CAT-B / CatB)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56419.94  
PI (pH):   %s   6.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSGSNSTFWTTNSGAPVWNNNSALTVGERGPILLEDYHLIEKLAQFDRERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVVHERGSPETLRDPRGFAVKFYTRGNFDLVGNNMPVFFIRDGMKFPDMVHAFKPSPKTNMQENWRIVDFFSHHPESLHMFSFLFDDVGIPLNYRHMEGFGVNTYTLINKDGKPHLVKFHWKPTCGVKCLLDDEAVTVGGTCHSHATKDLTDSIAAGNYPEWKLYIQTIDPDHEDRFDFDPLDVTKTWPEDIIPLQPVGRMVLNKNIDNFFAENEQLAFCPAIIVPGIHYSDDKLLQTRIFSYADTQRHRLGPNYLMLPVNAPKCAYHNNHHDGSMNFMHRDEEVNYFPSRFDAARHAEKVPIPPRVLTGCREKCVIDKENNFQQAGERYRSFDPARQDRFLQRWVDALSDPRITHELRGIWISYWSCDASLGQKLASRLNLKPNM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo , 7 introns), 6 cDNA and 265 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGGTGCCGCCTTTTCCTGATTTTCTTTTCTTCTAGATCGATCGTCGATTTGGTTTGGTTTGGTTTCTTGATGCGCTCATCCCAATCTGACTGACTCACTGGATTCCT
CCTCCTTGCAGCATCGGCCGTCCAGCGGGAGCAATTCCACCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAACAACTCCGCCCTCACCGTCGGAGAGCGAGGTACTGAGCTGC
TCCATCCTCCATCTTCCTCATCTCTTCCTCCACGAATCTATACTTCCTATCGATCCATGTGCTTTATGTCTGCTTAGAGGCGTATTTGGGCTTGCTTCCATCATGATCCAATGTTAACTT
TGAGCGATCAGATGCTTAATAATTTGTCTGTGTCTGGTAGCAACAGAAAAGGTCCCTGGATCTGTGTGAATTGGACTGTAGCACGACGTGTGCGATCTTGCCTTACTATTGTTCCTTTAG
AGCTATTCAAAGTTTGCATCTTTGGTGTGGGGGGGTTTTCAGCCTTTTGCTTTGAGTAACATGTCCTTGTCACTACCTTGTGATTCATCTGTGCTGCTTACACACAAAGAGGAAGATCTC
TAGTTTGGTTGCACTATGTTCTTGTTATTGCTCGGTTACACTCCTTCATCAACGCTAAAAGACGCAGTCTTGATATTTTTCTCTGTCGCTGTCAATCTGTCATACCATTAATAAAGAACG
TATAAAAATTGACCTTTTCCCCATTCATAGTAGTGATTATCTCACTTGTCCTCAGTTCTAAAACAGCATTCTTGTTTTTTGGGGGTTTTTTTACCATTATCGGTTCACTTTACAAAGTAA
TCTGATGACGATCAAATTTACTGGAGTACCAGAGAAGCACAAGTCTATTTCATACATATATCCAACATGACTCAAGTTTCGAAAGTGACTGGAAGTCATGTTCCAAATGTCATGGTCACT
AAAAGTACCAAACTCTGACAAAGATGTATTTGCATCTAGAACTAAGTGCTTCTATCATCGATCTGTGAAGTTTTCTTTCTAGTGTTTTCCCTTTATTTATACTCAGCAACTCCTGTATTT
TTGCAATCTGTAATCATGGCTGTTTTGTGGTTTGACATGATGAATTCTTCAATCGACAGGCCCTATCCTCCTTGAGGACTATCATCTGATTGAAAAGCTTGCACAGTTTGACAGGGAGCG
TATCCCTGAACGTGTCGTTCATGCAAGGGGAGCCAGTGCCAAGGGATTTTTTGAGGTTACTCATGATATTTCTCACCTCACATGTGCTGATTTTCTCCGTGCTCCTGGTGTTCAGACCCC
AGTTATTGTTCGGTTCTCCACAGTCGTGCATGAGCGTGGAAGCCCTGAGACATTGAGGGATCCACGTGGTTTTGCTGTCAAGTTTTACACTAGAGAG
GTACTTGCTCTTTCGCTTCTTTC
TTTCATAGGATTGTAGGAGGGAGACATTCAGTATAATGTATTCTTCAAGCATAAGGCTGTAGAATCAAATGTCTAGTTGTTCTCAGTTGGTTAAGTAGAACATGAAAGATTGGTTGTCCT
TTACCTCCACACTCCATAGGTCCAGTGCATTGCTTAATCTTATATCTACTAAAGCAAATGAGGGTAATTTGGTCTTATATATCTCAAAAGTCTCACACATTGGACATATATCTAACCAGT
GTCACCTACAACTTTGTCTTACTGTTTATTTACTGATTTGCATTCAGTGCTGCCATATTTTGATATTTTCTGAGTCAATGCTTTTCAGGGTAATTTTGATCTTGTTGGGAACAATATGCC
TGTCTTTTTTATCCGAGATGGGATGAAATTCCCTGACATGGTCCATGCTTTCAAGCCAAGTCCAAAGACCAATATGCAGGAGAACTGGAGAATAGTTGATTTCTTTTCACACCACCCAGA
GAGCCTGCACATGTTCTCCTTCCTCTTTGACGATGTAGGCATCCCACTCAACTACAGGCACATGGAGGGTTTTGGTGTCAACACCTACACCCTAATCAATAAGGATGGAAAGCCTCACCT
TGTCAAATTCCACTGGAAGCCTACCTGTGGTGTCAAATGCCTGTTGGATGATGAAGCTGTGACTGTTGGCGGCACCTGCCACAGCCATGCCACGAAGGACTTGACTGATTCTATTGCAGC
AGGGAATTACCCAGAGTGGAAGCTTTACATCCAGACTATTGATCCTGATCATGAGGACAGATTTGACTTCGATCCTCTTGATGTCACCAAGACATGGCCAGAGGATATCATCCCCCTGCA
GCCAGTTGGACGGATGGTCCTGAACAAAAACATTGATAACTTCTTTGCAGAAAATGAACAGCTTGCTTTCTGCCCAGCGATAATTGTCCCTGGAATCCATTACTCTGATGATAAGCTGCT
CCAGACAAGAATTTTCTCCTATGCTGATACCCAAAGGCACCGTCTTGGCCCAAACTATTTGATGCTTCCTGTGAATGCACCAAAATGTGCATACCACAACAACCACCACGATGGCTCCAT
GAATTTCATGCACAGGGATGAAGAG
GTACTGTGTGTATATACTTTCAGAGATACATCTCCTGCATTCAGTTGTTGTGATGCATCTTTCTGTTTTTGTCCATTACATATTGTTTCTTCCAG
TCAACACAAACAGAATGGGACTATCATTCAGTTTATTGCATTTACATCTATTTGCCTTGTTTTTAGGTTAACTACTTCCCTTCAATTCAGTTTATTGCATTTACATCTATTTGCCTTGTT
TTTTAGGTTAACTACTTCCCTTCAAGGTTTGATGCTGCACGTCATGCTGAGAAGGTCCCTATTCCTCCTCGTGTTCTAACAGGCTGTCGGGAAAAGGTGTGTAACTTGGTCCACTTGAAC
TCCTTGCGCTGTTACCTTGTGAGCATGGTTTTGTCCCGCTACATTAGGAGACTATTTGCTGATTTGGAATGCGATGAAATATGTATTATAGATGTGGTACCCTGGAAAGTACAATGACCA
CATGCATTTGACACAATGTTTTCTGCCTCTCTTTTTTGTTGGAAATGCAGTGTGTCATTGACAAGGAGAACAATTTCCAACAGGCTGGTGAGAGATACCGGTCATTTGACCCTGCCAGGT
TTGTTCTTGTTCAATTTAATTCGTGTGAACACATCGAAGAGTTTGAGCAACAACGCTAATTAAACTTTTCTTTTTGTATGTAACACAGGCAAGATCGTTTTCTCCAGCGGTGGGTTGATG
CTCTCTCAGATCCTCGTATTACACATGAACTCCGTGGCATCTGGATCTCCTACTGGTCGCAG
GTAACATAATTTCTTCGTGGGTGCAAAGTGCTTATCAGTTGTCAGTGAGAGATCATGT
ACAATTGTACCTTGTATTGACACACTGAAACCATATATTTGTGTGTTGTTGCAGTGTGATGCGTCCCTTGGGCAGAAGCTGGCTTCACGTCTCAACCTGAAACCAAACATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGCATCGGCCGTCCAGCGGGAGCAATTCCACCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAACAACTCCGCCCTCACCGTCGGAGAGCGAGGCCCTATC
CTCCTTGAGGACTATCATCTGATTGAAAAGCTTGCACAGTTTGACAGGGAGCGTATCCCTGAACGTGTCGTTCATGCAAGGGGAGCCAGTGCCAAGGGATTTTTTGAGGTTACTCATGAT
ATTTCTCACCTCACATGTGCTGATTTTCTCCGTGCTCCTGGTGTTCAGACCCCAGTTATTGTTCGGTTCTCCACAGTCGTGCATGAGCGTGGAAGCCCTGAGACATTGAGGGATCCACGT
GGTTTTGCTGTCAAGTTTTACACTAGAGAG
GGTAATTTTGATCTTGTTGGGAACAATATGCCTGTCTTTTTTATCCGAGATGGGATGAAATTCCCTGACATGGTCCATGCTTTCAAGCCA
AGTCCAAAGACCAATATGCAGGAGAACTGGAGAATAGTTGATTTCTTTTCACACCACCCAGAGAGCCTGCACATGTTCTCCTTCCTCTTTGACGATGTAGGCATCCCACTCAACTACAGG
CACATGGAGGGTTTTGGTGTCAACACCTACACCCTAATCAATAAGGATGGAAAGCCTCACCTTGTCAAATTCCACTGGAAGCCTACCTGTGGTGTCAAATGCCTGTTGGATGATGAAGCT
GTGACTGTTGGCGGCACCTGCCACAGCCATGCCACGAAGGACTTGACTGATTCTATTGCAGCAGGGAATTACCCAGAGTGGAAGCTTTACATCCAGACTATTGATCCTGATCATGAGGAC
AGATTTGACTTCGATCCTCTTGATGTCACCAAGACATGGCCAGAGGATATCATCCCCCTGCAGCCAGTTGGACGGATGGTCCTGAACAAAAACATTGATAACTTCTTTGCAGAAAATGAA
CAGCTTGCTTTCTGCCCAGCGATAATTGTCCCTGGAATCCATTACTCTGATGATAAGCTGCTCCAGACAAGAATTTTCTCCTATGCTGATACCCAAAGGCACCGTCTTGGCCCAAACTAT
TTGATGCTTCCTGTGAATGCACCAAAATGTGCATACCACAACAACCACCACGATGGCTCCATGAATTTCATGCACAGGGATGAAGAG
GTTAACTACTTCCCTTCAAGGTTTGATGCTGCA
CGTCATGCTGAGAAGGTCCCTATTCCTCCTCGTGTTCTAACAGGCTGTCGGGAAAAG
TGTGTCATTGACAAGGAGAACAATTTCCAACAGGCTGGTGAGAGATACCGGTCATTTGACCCT
GCCAG
GCAAGATCGTTTTCTCCAGCGGTGGGTTGATGCTCTCTCAGATCCTCGTATTACACATGAACTCCGTGGCATCTGGATCTCCTACTGGTCGCAGTGTGATGCGTCCCTTGGGCAG
AAGCTGGCTTCACGTCTCAACCTGAAACCAAACATGTAG

Retrieve as FASTA