Entry information : OsKat01 (CAT-A / CatA)
Entry ID 5146
Creation 2007-04-08 (Christophe Dunand)
Last sequence changes 2007-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsKat01 (CAT-A / CatA)
Name (synonym) OsKat01 (CAT-A / CatA)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Flowers
Inflorescences
Leaves
Mixed tissues
Roots
Seeds
Stems
Vegetative tissues
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsKat01
start..stop
S start..stop
SpKat01 910 0 1..492 1..493
SbKat01 908 0 1..492 1..493
ZmKat3 889 0 1..492 2..495
OsiKat01 865 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 827556..827570 15 N° 2 826467..827267 801 N° 3 825778..826380 603 N° 4 825369..825428 60
complement(join(825369..825428,825778..826380,826467..827267,827556..827570))


exon

Literature and cross-references OsKat01 (CAT-A / CatA)
Literature REFERENCE 1 Mori H., Higo K., Higo H., Minobe Y., Matsui H., Chiba S. Nucleotide and derived amino acid sequence of a catalase cDNA isolated from rice immature seeds. Plant Mol. Biol. 18:973-976(1992).
REFERENCE 2 Higo K., Higo H. Cloning and characterization of the rice CatA catalase gene, a homologue of the maize Cat3 gene. Plant Mol. Biol. 30:505-521(1996).
Protein ref. UniProtKB:   Q0E4K1   A3A2F1 [Other strain] UniProtKB_Uniparc:   A2X035 [Other strain]
DNA ref. GenBank:   NC_008395.1 (827570..825372)
Cluster/Prediction ref. UniGene:   Os.9172
Protein sequence: OsKat01 (CAT-A / CatA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56531.11  
PI (pH):   %s   7.01
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPCKFRPSSSFDTKTTTTNAGAPVWNDNEALTVGPRGPILLEDYHLIEKVAHFARERIPERVVHARGASAKGFFECTHDVTDITCADFLRSPGAQTPVIVRFSTVIHERGSPETIRDPRGFAVKFYTREGNWDLLGNNFPVFFIRDGIKFPDVIHAFKPNPRSHVQEYWRVFDFLSHHPESLHTFFFLFDDVGIPTDYRHMDGFGVNTYTFVTRDAKARYVKFHWKPTCGVSCLMDDEATLVGGKNHSHATQDLYDSIAAGNFPEWKLFVQVIDPEEEERFDFDPLDDTKTWPEDEVPLRPVGRLVLNRNVDNFFNENEQLAFGPGLVVPGIYYSDDKMLQCRVFAYADTQRYRLGPNYLMLPVNAPKCAHHNNHYDGAMNFMHRDEEVDYYPSRHAPLRHAPPTPITPRPVVGRRQKATIHKQNDFKQPGERYRSWAPDRQERFIRRFAGELAHPKVSPELRAIWVNYLSQCDESLGVKIANRLNVKPSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 2 introns), 9 cDNA and 763 ESTs. Cultivar=Indica" and "Japonica".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTGCAAGGTCAGTCACTCAGTGACTAGTGAGACTAAATCTACTTAATCTTGTAGTTAATAATTGAGGTTTCATTTAGCTAGTTGTGTAGATTCAAGAGAGAGCTTAACTTCT
TATAGAATATTTGGTCGATTATCAGAAACTTCCTGAAATAACCTAGATTATCGACTAGATTCTACGAATATTTCTTTTTTAGTCTCAAGCTCTTCAAACATGCATGGCTGGTTGATTCAG
CTAGTCGATCATTAAGTATATAATTAATTAATTAATTAATAGTAATACGTGCTACCCATGCAGTTCCGGCCGTCGAGCTCGTTCGACACGAAGACGACGACGACGAACGCGGGAGCTCCG
GTGTGGAACGACAACGAGGCGCTGACAGTGGGGCCCAGGGGGCCGATCCTCCTCGAGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCCCGGGAGCGCATCCCGGAGCGCGTGGTC
CACGCCCGCGGCGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACGACGTCACCGACATCACCTGCGCCGACTTCCTCCGGTCCCCGGGCGCCCAGACCCCCGTCATCGTCCGCTTCTCC
ACCGTCATCCACGAGCGCGGCAGCCCGGAGACGATCCGCGACCCGCGCGGGTTCGCCGTCAAGTTCTACACCCGCGAGGGCAACTGGGACCTCCTCGGCAACAACTTCCCCGTCTTCTTC
ATCCGCGACGGCATCAAGTTCCCCGACGTCATCCACGCCTTCAAGCCCAACCCGCGCTCCCATGTCCAGGAGTACTGGAGGGTCTTCGACTTCTTGTCCCACCACCCCGAGAGCCTCCAC
ACCTTCTTCTTCCTCTTCGACGACGTCGGCATCCCCACCGATTACCGCCACATGGACGGCTTCGGCGTCAACACCTACACCTTCGTCACCCGCGACGCCAAGGCCAGGTACGTCAAGTTC
CACTGGAAGCCCACCTGCGGCGTCAGCTGCTTGATGGACGACGAGGCCACGCTCGTCGGCGGCAAGAACCACAGCCACGCCACCCAGGACCTCTACGACTCCATCGCCGCCGGCAACTTC
CCCGAGTGGAAGCTGTTCGTCCAG
GTAGGTGATCATCCAGAAATTAACGCCTATACGATCTGAGTTCGAAGCCGCAGTACTCCTTCTAATTAATTATTTAATACTGTTAGGTGATCGACC
CGGAGGAGGAGGAGAGGTTCGACTTCGACCCGCTGGATGACACCAAGACATGGCCGGAGGACGAGGTGCCGCTCCGGCCCGTGGGGCGCCTCGTTCTCAACCGCAACGTCGACAACTTCT
TCAACGAGAACGAGCAGCTGGCGTTCGGGCCGGGGCTGGTGGTGCCGGGGATCTACTACTCCGACGACAAGATGCTGCAGTGCAGGGTGTTCGCGTACGCCGACACGCAGCGCTACAGGC
TGGGGCCAAACTACCTGATGCTGCCGGTGAACGCGCCCAAGTGCGCCCACCACAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCATCGC
GCCACGCGCCGCTCCGCCACGCGCCGCCGACGCCCATCACGCCGCGCCCCGTGGTGGGGAGGAGGCAGAAGGCGACGATACACAAGCAGAACGACTTCAAGCAGCCCGGGGAGAGGTACA
GGTCGTGGGCGCCGGATAGACAGGAGAGGTTCATCCGCCGCTTCGCCGGCGAGCTCGCGCACCCCAAGGTCTCCCCTGAGCTCCGCGCCATCTGGGTCAACTACCTCTCCCAG
GTAATTC
ATACCAGCAATTTAGTATTACCTCCATTTTTGTTTTTATGACACTACTAGTTAAAGTTTGAACTAATCAACGTCATATAAAAAAAACGGAGGGAGTAGTTATTAGTAATGATTAATTGTT
TTCTCTTAGTTAATCCACATGATTAACACCATGTTTAGCACAACAGTTTTATGAATCCATAGATAAATTATTTAATCCTATTTTATATGAAATATATAATTTTAAACCACTGTAGAGAAT
TTGAAATTAATATGACTTAATCGCTATTAATTTGCACTAATTCCGGCAAAAAAAGCTATTAATTTGCACTAACTATGTAATTAACTCATTTACTTCATGCAGTGTGATGAGTCGTTGGGG
GTGAAGATTGCGAATAGGCTCAACGTGAAGCCAAGCATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTGCAAGTTCCGGCCGTCGAGCTCGTTCGACACGAAGACGACGACGACGAACGCGGGAGCTCCGGTGTGGAACGACAACGAGGCGCTGACAGTGGGGCCCAGGGGGCCGATC
CTCCTCGAGGACTACCACCTGATCGAGAAGGTGGCGCACTTCGCCCGGGAGCGCATCCCGGAGCGCGTGGTCCACGCCCGCGGCGCCTCCGCCAAGGGCTTCTTCGAGTGCACCCACGAC
GTCACCGACATCACCTGCGCCGACTTCCTCCGGTCCCCGGGCGCCCAGACCCCCGTCATCGTCCGCTTCTCCACCGTCATCCACGAGCGCGGCAGCCCGGAGACGATCCGCGACCCGCGC
GGGTTCGCCGTCAAGTTCTACACCCGCGAGGGCAACTGGGACCTCCTCGGCAACAACTTCCCCGTCTTCTTCATCCGCGACGGCATCAAGTTCCCCGACGTCATCCACGCCTTCAAGCCC
AACCCGCGCTCCCATGTCCAGGAGTACTGGAGGGTCTTCGACTTCTTGTCCCACCACCCCGAGAGCCTCCACACCTTCTTCTTCCTCTTCGACGACGTCGGCATCCCCACCGATTACCGC
CACATGGACGGCTTCGGCGTCAACACCTACACCTTCGTCACCCGCGACGCCAAGGCCAGGTACGTCAAGTTCCACTGGAAGCCCACCTGCGGCGTCAGCTGCTTGATGGACGACGAGGCC
ACGCTCGTCGGCGGCAAGAACCACAGCCACGCCACCCAGGACCTCTACGACTCCATCGCCGCCGGCAACTTCCCCGAGTGGAAGCTGTTCGTCCAG
GTGATCGACCCGGAGGAGGAGGAG
AGGTTCGACTTCGACCCGCTGGATGACACCAAGACATGGCCGGAGGACGAGGTGCCGCTCCGGCCCGTGGGGCGCCTCGTTCTCAACCGCAACGTCGACAACTTCTTCAACGAGAACGAG
CAGCTGGCGTTCGGGCCGGGGCTGGTGGTGCCGGGGATCTACTACTCCGACGACAAGATGCTGCAGTGCAGGGTGTTCGCGTACGCCGACACGCAGCGCTACAGGCTGGGGCCAAACTAC
CTGATGCTGCCGGTGAACGCGCCCAAGTGCGCCCACCACAACAACCACTACGACGGCGCCATGAACTTCATGCACCGGGACGAGGAGGTGGACTACTACCCATCGCGCCACGCGCCGCTC
CGCCACGCGCCGCCGACGCCCATCACGCCGCGCCCCGTGGTGGGGAGGAGGCAGAAGGCGACGATACACAAGCAGAACGACTTCAAGCAGCCCGGGGAGAGGTACAGGTCGTGGGCGCCG
GATAGACAGGAGAGGTTCATCCGCCGCTTCGCCGGCGAGCTCGCGCACCCCAAGGTCTCCCCTGAGCTCCGCGCCATCTGGGTCAACTACCTCTCCCAG
TGTGATGAGTCGTTGGGGGTG
AAGATTGCGAATAGGCTCAACGTGAAGCCAAGCATGTGA

Retrieve as FASTA