Entry information : MtKat01 (Medtr3g115370.1[4.0])
Entry ID 5152
Creation 2008-10-09 (Christophe Dunand)
Last sequence changes 2008-10-09 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtKat01 (Medtr3g115370.1[4.0])
Name (synonym) MtKat01 (Medtr3g115370.1[4.0])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Cell culture
Leaves
Pods
Roots
Seedlings
Seeds
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtKat01
start..stop
S start..stop
PsKat01 967 0 1..492 1..494
GmKat04 967 0 1..492 1..492
LjKat01 963 0 1..492 1..492
PauKat01 961 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53951272..53951286 15 N° 2 53951450..53951546 97 N° 3 53952621..53952898 278 N° 4 53953439..53954215 777
N° 5 53954367..53954456 90 N° 6 53954882..53954949 68 N° 7 53955037..53955130 94 N° 8 53955239..53955298 60
join(53951272..53951286,53951450..53951546,53952621..53952898,53953439..53954215 ,53954367..53954456,53954882..53954949,53955037..53955130,53955239..53955298)


exon

Literature and cross-references MtKat01 (Medtr3g115370.1[4.0])
Literature He,X.-Z., Shadle,G., Scott,A.D., Harris,A.R., Gonzales,R.A., Bell ,C.J., Flores,H.R., Inman,J.T., Weller,J.W., May,G.D. and Dixon ,R.A. Expressed Sequence Tags from the Samuel Roberts Noble Foundation Medicago truncatula stem library
DNA ref. Phytozome 11:   chr3 (53951272..53955298)
EST ref. GenBank:   CB891887 [Different splicing]
Cluster/Prediction ref. Phytozome Gene 11:   31053684 UniGene:   Mtr.3811
Omic ref. Gene atlas:   Mtr.37587.1.S1_at Legoo:   Mtr.37587.1.S1_at
Protein sequence: MtKat01 (Medtr3g115370.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56550.08  
PI (pH):   %s   7.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSAYNSPFWTTNSGAPVWNNNSSLTVGSRGPILLEDYHLVEKLAQFDRERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFVHDGMNFPDMVHALKPNPKSHIQENWRILDFFSHFPESLHMFSFLFDDVGVPQDYRHMDGFGVNTYSLINKAGKAVYVKFHWKPTCGVKCLLEEEAIKVGGANHSHATQDLYDSIAAGNYPEWKLFVQTIDPAHEDKFDFDPLDVTKTWPEDIIPLQPVGRLVLNKNIDNFFAENEQLAFCPAIIVPGVYYSDDKMLQTRIFSYADSQRHRLGPNYLQLPANAPKCAHHNNHHEGFMNFIHRDEEVNYFPSRHDPVRHAEKVPIPTANFSACREKCNIPKQNNFKQPGERYRSWAPDRQDRFLRRWVDALSDPRVTHEIRSIWISYWSADRSLGQKIASHLNMRPSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 7 introns). 27 ESTs. Four independent TC, one unigene. No other Kat found????
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAAGGTATACAACAATACTTCAATCTTTTTTCATTGCTTTCTGTCTCTGATTTTATGATTCATTCATTCAATTTTCTTTTTTGTTCATTCTATAGGTTTTTTAATTTAT
TTATCGAAGCAATTTTTATTGTCTCGTTCAAGTGTTAATTTTGTTAATTTCGTTACAGCACCGTCCGTCCAGCGCTTACAATTCTCCTTTCTGGACTACAAATTCTGGCGCACCTGTTTG
GAATAACAACTCATCCCTAACCGTTGGATCCAGAG
GTATATCTAATTAATCAACAACTTATCCAACCATCTTTCATTTAATCCTTTTTTTTTATTTTTTATTTATCTTATTTGATGAAAT
TGTTTAACTATATCTTTAAATTATTCTTTTAACATAATTTGATTTCTTGCCAGCAAAGTTTAATCACCGTTAAATTATATGATTTCACGGCTCTTTGATTTTCCAGTTTAATATTATGAC
ATCCATGCATGTGATTAAGGCGCTTCAAGCACTTATCAAATACGCGCTTATACTATAAGGCCATGTTTGGATAAACAACTTATCAACTACTTATTATATAAGTTCTTGTGTGTAAGTTAT
TTTTATAATAATAAAAGATGAAATTAAATTAAATCGCTTTCATATAAGTTATAAATTATTAACAACGATTTAGAGATCATTGAGTTGGTATATGATAGAATATTACGGTGCCGTTTGATC
CATATAGCCGACCCCACATAGTGGGATAAGGCTTGATTGGTTGTTTTTGTAGTTATAAGTTGTTTTCATAAACTATAATAACCGAGAGTTTATGAAAATAAGCTGAAAACAGCTCATGAA
CATGTTATCAGCTGTTTTCATAAGTTCTCTTAAACAGTTTCACATGTACGATAATCTCAACTAAGCCTATACAAACAGGCCCAACTGTTTTTTGATATAACTGAAGCTATAATGTGAGAA
AACTCGTTTTCTAAACTTTGTATAAGCTATTTTTATTTTATTATGAGCAGCTTATGGAAATAAGCTAAAAACCAGTTATGACACATCATAACTTTTTTGTACGCTCTTACAAAAACTTAG
ACTAGTGTTTATATCATAAAAAGTCAAAGTAAACCCTCCTGATTGCTCCATGTGTGCTAACAGTGCTGTATGGTCCAATTTTTATATAAAACCACACTACATTTAGTTGAGTGTCGTGGA
CTTTGATTTTCGTAATTAGTTATCACCCTTGGTAATTACAACTTGGAGAATATTCTCCATCTGTCTGTTGTAAAGTTGAGGGTTAATTTGGACAAATAATAAAGTATCATGTAAGCAGAA
ATTATATATTATTTTACCCCTTTTGGCAGGTCCAATTCTCTTGGAAGATTATCATCTTGTGGAAAAGCTTGCCCAATTTGATAGGGAACGGATCCCAGAACGTGTTGTCCATGCCAGGGG
AGCAAGTGCAAAGGGTTTCTTTGAAGTCACACATGATATTTCGCACCTGACTTGTGCAGATTTCCTACGAGCTCCTGGAGTTCAGACACCCGTCATTGTGCGTTTCTCCACTGTCATTCA
TGAACGTGGTAGCCCTGAAACCTTGAGAGACCCTCGAGGTTTTGCTGTGAAATTTTACACCAGAGAG
GTAGAAATTAATGAATATATAGCATCATTTTATATCTCCATATCTTCTAGTGA
CTAAATACAGTTACTGTAGCAGTTCGAATTTTGTTCACATGTTCTTTTTAAGCAACTCCAGTTTAGTTGGTAAAATGCTGATAATAGTTTCAACACGATCATACAAGCAAAAGATGCATA
ATGTGATTTAACCCCATATGTAGCATTTAATTAAACAATCTGGTCTAGTGATTTGATTATTCGATTACCTGAAAAAATTGAAGACATGCATTGTTGGTTTGAGTCCAGCATTGTCTAAAT
CCTTTGTACTTTGAAATTTCAAGCTAGAGATAAAGATTATGTAGCATAATTAAAAATTATCTTCCAGTGACTAAATATAATTACAGTATTAGTTTAAAATTGCGTCATTTATGAATGTAG
TTGCAGTTGTAACCAGGATGCTAGTGTATTTGCTTAAATGCTGACAATAATTGTTTTAGAAGAGGTGATATGGAACAGTTGGAGTCTTGTACCATAAATTATTCTTATCTTTACCTTCTG
AACACAGGGTAACTTTGACCTTGTTGGAAACAACTTTCCTGTCTTCTTCGTTCACGACGGGATGAATTTTCCAGATATGGTCCATGCTCTTAAACCCAACCCCAAGTCCCACATTCAGGA
GAATTGGAGAATCCTTGACTTCTTTTCTCACTTTCCAGAAAGCCTTCACATGTTCTCCTTCCTATTTGATGATGTGGGTGTCCCACAAGATTATAGGCACATGGATGGTTTTGGAGTTAA
CACATATTCCCTGATCAACAAGGCTGGGAAAGCAGTGTACGTGAAATTTCACTGGAAGCCCACATGTGGTGTGAAGTGTCTGTTGGAGGAAGAGGCCATTAAGGTGGGAGGAGCCAACCA
CAGCCATGCTACTCAAGACCTGTATGATTCAATTGCTGCTGGTAACTATCCTGAGTGGAAACTGTTTGTTCAAACAATAGATCCTGCTCACGAAGACAAATTTGATTTTGACCCACTTGA
TGTAACTAAGACTTGGCCTGAGGACATTATACCCCTTCAGCCCGTAGGTCGCCTGGTCTTGAACAAGAACATAGACAATTTCTTTGCTGAGAATGAACAACTTGCATTTTGTCCTGCCAT
TATTGTGCCTGGTGTATATTACTCGGATGATAAGATGCTTCAAACCAGGATTTTCTCTTATGCTGATTCACAGAGGCACAGGCTTGGGCCAAACTATCTGCAACTTCCTGCTAATGCTCC
CAAGTGTGCTCACCACAACAATCACCATGAGGGTTTCATGAATTTCATTCACAGGGATGAAGAG
GTAATTTAATGTTTCATTTATCTATTAATATTCTGCTTTTTCATCTTTAGTGCAAG
AAGCCGATTGCCATGATAAACTAAATGTGATATTGCATCTTATTCTTTAGTTATATACAGTCTTTTCTCATGACTTGAGCTCTGCCATTTTATAGGTCAATTACTTCCCTTCAAGGCATG
ATCCTGTTCGTCATGCAGAAAAGGTTCCCATTCCTACTGCTAATTTCTCTGCATGCCGTGAAAAG
GTTAGTTTCCATAAATTGCTTAATATGAAAATATGATATGTGTTGTGAACTTGTG
AGTGAATCCATCAGCCGTGATTTTTACGATTGATTGCATTACCTTATTTAATTTATTTATTTATTTTTGTCTAAGAAACCACACATTTTAGAAACAACAAATCTATGATCTTTCGTTGGA
TACAGTATGAAAATTGTTCTGACAAAGAAGCAGAGAAATAGGTCTACTACCTTGGTTAAATATTAAGTTGGTGCAAATTAATTTGAAGTTTAGGTAGCACTTATTTTTAGCAGTACTTTT
ACATAAATTGATAATTATTGTTTTATAAAATAAATGACGAGTGAGGATCAATTAAATAGTGTCAGTGAAGCTGTTTAAACAATACCTGTATTGGGGAAGAATGTATGAACAATTTTACTT
CTTAATGCAGTGCAATATTCCAAAGCAGAACAACTTCAAGCAGCCTGGAGAGCGATACCGATCTTGGGCACCCGACAGGTTCCTGTTACAAAATACTGATATGATCAACATGAATTGTGT
TTGGCGATGTCTAATATTTGGTTTTCTTTGCCATAATCTTTTCAGGCAAGATAGATTTCTCCGCAGATGGGTGGATGCTTTATCCGATCCACGCGTCACCCATGAAATCCGCAGCATCTG
GATCTCATACTGGTCTCAG
GTGAGATTTAGACATGCTAATTTATCAAACTAGAAACTTCAGAGCAGTCAAGTGCAAATGCATCCCTACTTATTTGCTCATATGCTCTTTGTTGGTTTTAC
TATGCAGGCTGATCGTTCTCTTGGACAAAAGATTGCATCTCATCTGAACATGAGGCCTAGCATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAAGCACCGTCCGTCCAGCGCTTACAATTCTCCTTTCTGGACTACAAATTCTGGCGCACCTGTTTGGAATAACAACTCATCCCTAACCGTTGGATCCAGAGGTCCAATT
CTCTTGGAAGATTATCATCTTGTGGAAAAGCTTGCCCAATTTGATAGGGAACGGATCCCAGAACGTGTTGTCCATGCCAGGGGAGCAAGTGCAAAGGGTTTCTTTGAAGTCACACATGAT
ATTTCGCACCTGACTTGTGCAGATTTCCTACGAGCTCCTGGAGTTCAGACACCCGTCATTGTGCGTTTCTCCACTGTCATTCATGAACGTGGTAGCCCTGAAACCTTGAGAGACCCTCGA
GGTTTTGCTGTGAAATTTTACACCAGAGAG
GGTAACTTTGACCTTGTTGGAAACAACTTTCCTGTCTTCTTCGTTCACGACGGGATGAATTTTCCAGATATGGTCCATGCTCTTAAACCC
AACCCCAAGTCCCACATTCAGGAGAATTGGAGAATCCTTGACTTCTTTTCTCACTTTCCAGAAAGCCTTCACATGTTCTCCTTCCTATTTGATGATGTGGGTGTCCCACAAGATTATAGG
CACATGGATGGTTTTGGAGTTAACACATATTCCCTGATCAACAAGGCTGGGAAAGCAGTGTACGTGAAATTTCACTGGAAGCCCACATGTGGTGTGAAGTGTCTGTTGGAGGAAGAGGCC
ATTAAGGTGGGAGGAGCCAACCACAGCCATGCTACTCAAGACCTGTATGATTCAATTGCTGCTGGTAACTATCCTGAGTGGAAACTGTTTGTTCAAACAATAGATCCTGCTCACGAAGAC
AAATTTGATTTTGACCCACTTGATGTAACTAAGACTTGGCCTGAGGACATTATACCCCTTCAGCCCGTAGGTCGCCTGGTCTTGAACAAGAACATAGACAATTTCTTTGCTGAGAATGAA
CAACTTGCATTTTGTCCTGCCATTATTGTGCCTGGTGTATATTACTCGGATGATAAGATGCTTCAAACCAGGATTTTCTCTTATGCTGATTCACAGAGGCACAGGCTTGGGCCAAACTAT
CTGCAACTTCCTGCTAATGCTCCCAAGTGTGCTCACCACAACAATCACCATGAGGGTTTCATGAATTTCATTCACAGGGATGAAGAG
GTCAATTACTTCCCTTCAAGGCATGATCCTGTT
CGTCATGCAGAAAAGGTTCCCATTCCTACTGCTAATTTCTCTGCATGCCGTGAAAAG
TGCAATATTCCAAAGCAGAACAACTTCAAGCAGCCTGGAGAGCGATACCGATCTTGGGCACCC
GACAG
GCAAGATAGATTTCTCCGCAGATGGGTGGATGCTTTATCCGATCCACGCGTCACCCATGAAATCCGCAGCATCTGGATCTCATACTGGTCTCAGGCTGATCGTTCTCTTGGACAA
AAGATTGCATCTCATCTGAACATGAGGCCTAGCATTTAA

Retrieve as FASTA