Entry information : PtKat01 (POPTR_0002s01080 / Potri.002G009800)
Entry ID 5155
Creation 2007-04-08 (Christophe Dunand)
Last sequence changes 2010-07-08 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtKat01 (POPTR_0002s01080 / Potri.002G009800)
Name (synonym) PtKat01 (POPTR_0002s01080 / Potri.002G009800)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue types Buds
Leaves
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtKat01
start..stop
S start..stop
PdelKat01 1031 0 1..492 1..492
GhKat01 989 0 1..492 1..492
PpeKat01 987 0 1..492 1..492
PtKat02 981 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 571335..571349 15 N° 2 571008..571104 97 N° 3 569904..570181 278 N° 4 568647..569423 777
N° 5 568380..568469 90 N° 6 568068..568135 68 N° 7 567876..567969 94 N° 8 567719..567778 60
complement(join(567719..567778,567876..567969,568068..568135,568380..568469,5686 47..569423,569904..570181,571008..571104,571335..571349))


exon

Literature and cross-references PtKat01 (POPTR_0002s01080 / Potri.002G009800)
Literature Ralph,S., et al., Genomics of hybrid poplar (Populus trichocarpax deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences. Mol. Ecol. 15 (5), 1275-1297 (2006).
DNA ref. Phytozome 11:   scaffold_2 (571349..567719)
Cluster/Prediction ref. UniGene:   Pth.3772
Omic ref. ePlant:   Potri.002G009800
Protein sequence: PtKat01 (POPTR_0002s01080 / Potri.002G009800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56490.11  
PI (pH):   %s   7.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSAFGTPYWTTNSGAPVWNNNSSLTVGSRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDISGLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFIRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLFDDLGVPQDYRHMEGSGVNTYMLINKAGKAHYVKFHWKPTCGVKCLLEDEAVKVGGTNHSHATQDLYDSIAAGTYPEWKLFIQTIDPDHEARFDFDPLDVTKTWPEDILPLQPVGRLVLNKNIDNFFAENEQLAFCPAIVVPGVYYSDDKLLQTRIFSYADTQRHRLGPNYLQLPANAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRYDPVRHAESFPIPPAVCSGKREKCIIEKENNFKQPGERYRSWAPDRQERFICRWVDALSDPRVTHEIRSIWISYWSADKSLGQKLASRLNVRPSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 10 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGGTACCGATTCTTCCTCATCCATCTTGTATTTTTGATTGAAAACATGTTTTTCTCCTCTTTTTTATGTATGAAATTATTCGACGAAGGAGCTTGTAGCTTAACTGT
CACCCATCCTTGGAATTAGAGCCTAATAAAAAGATTAGATTAGTGATGTTGTGGTGTTGTATTGTTTTTTTTTTTTTTTTGCCGTTTGATCATCATTTTGACTAATTCGATGGTGGTGGT
GGCAGTACCGTCCATCAAGCGCTTTCGGTACTCCATACTGGACTACAAATTCTGGAGCTCCGGTTTGGAACAACAACTCGTCTTTGACCGTTGGATCTAGAGGTATTTTTTGTTTCTTAA
ATCTATGGTTGCTGAGCTAGATAATTAATTGCTAGGTTAAGGTGTATGTATGCTTGTCTGGTTTGGATATTGTTCTGATATGTTAATGTTTTTTAAGACTGTTGCTGTGTTTATGTTGAT
AAAGATTGACTTTTCAGTGTAGTAATTTGTTGTCCATTTTGGAAGAATTATTATTTAATTTGAGTTATTATCAGTTTTTTTTTTGGTTTCTCGCTGTATCTTTGTGATTGGTTATTTGAT
GCTTCCTATGTTTCCGCTGAATTTTAAATGTCAAGGATGAATTAAGTAGCATATTTAGAGAGTTATGGTTAAGATTGATGCAAGAAAAAGGTAGGAGTTATTGTACTGTTGTCGAAATCA
TTATGCTGGTGGCAAGCTTATAGCAGAATGTGAAGTTTCCGATCAGATGCAAAATGATTTGAGGAGCAGGGCCTTTTTGGGTCTGGTTGATTTTTTTATTTGAGGTTGGATATTGTGATT
CAAGTCGAGCTTATTTATATAATATAAAGTCAGCTTAATCGTGAGCCAGGGCAAACCTCGTGCTGAAAGGCAGAATGTATTAAATGAACCCAGATCAAGTACTGGCATGTTGTTTTTAGT
CAGAATCAGTGTTATGAATGTCTATGCATTGTAGAGTGAATTTTTAGAAGTGTTTTTTCCCTCCCTTTTTTGCTGTAAGTTTTATAATGATTGTAGTGGTATGACTTGGAGAGTAACTTT
GAGTTGTTGGGAATGTATTTTTGCTTGTCATGTAGAGTGAGGATTAAGACACTGAGGTTTGATCTGCATATACTTTTTTCTCTGACAGGTCCAATCCTCCTTGAGGATTACCATCTGGTG
GAGAAGCTTGCCAATTTTGACAGGGAGAGGATTCCAGAGCGTGTTGTCCATGCTAGGGGAGCCAGTGCAAAGGGTTTCTTTGAGGTTACCCATGATATCTCTGGCCTCACATGTGCTGAT
TTTCTCCGGGCTCCTGGAGTTCAGACACCTGTCATTGTCCGCTTCTCCACAGTTATCCATGAGCGTGGCAGCCCTGAAACCCTGAGGGATCCACGTGGATTTGCAGTGAAGTTTTACACC
AGAGAG
GTGAGGTCTTATTTGATGTTTTATTTCTGTTAGTGTGATATGGTGGAGGAAAGCAAATGTGTGAGGCACCGATGATGATGTAGACAGATTCAGCAGATATATCACATCCATAGG
GATCGATGAATTAAAGTTTAATATGATTATCCCACAAAGTTTTAGATGTTCATAAATGTATTGTTTGCAAAATCTTTATCTGCTTGTTTTGATGAAGGTTTGACTGGCATGAATAAGACT
TGAGAAAAGAGAGAACTTAATTCTTTTTCCTATTTGTGTGTCTCAATTCACCAGCATGAATGTTGTTGTTTTTCTATACTCAAACAACAAGGCATAACCTTTTACATCCGTGAAGCTTTG
TTTTTGTGCATTATTCCTTTACATAGGAATAATTAATTCTAGTTGATTGTATGAAGTTTATTGCTTTAGCTTTTCAAGGTTCCAATTTTCTTATTCTCTATGCCCTTCCTTGACTTGTTA
ATTCAGGGTAACTTTGATCTCGTGGGAAACAATTTCCCTGTCTTCTTCATCCGTGATGGAATGAAATTCCCAGACATGGTGCATGCCCTTAAGCCCAACCCTAAGTCTCATATTCAGGAG
AACTGGAGGATTCTTGACTTCTTCTCCCACCATCCTGAAAGTTTGCACATGTTCTCCTTCCTATTTGATGATTTGGGTGTTCCACAAGATTATAGACATATGGAAGGCTCTGGTGTTAAC
ACCTACATGTTGATCAACAAGGCTGGAAAAGCCCATTATGTGAAATTTCATTGGAAACCTACTTGTGGTGTGAAATGTTTGTTGGAGGATGAGGCAGTTAAAGTAGGAGGCACAAATCAC
AGTCATGCTACTCAGGATCTATATGACTCCATTGCAGCTGGCACCTATCCTGAGTGGAAACTTTTCATCCAGACAATTGATCCTGACCATGAAGCCAGGTTTGATTTTGACCCACTTGAT
GTAACCAAGACCTGGCCTGAGGATATCTTGCCCCTGCAGCCAGTTGGTCGCTTGGTCTTGAATAAGAACATCGACAACTTCTTTGCTGAAAATGAGCAGCTTGCTTTCTGCCCTGCTATT
GTGGTTCCTGGTGTTTACTATTCAGATGACAAGCTACTCCAGACTCGAATCTTCTCCTATGCTGATACCCAGAGGCACCGTCTTGGACCAAACTATCTGCAGCTCCCTGCTAATGCTCCC
AAGTGTGCTCATCATAACAATCACCATGAAGGTTTCATGAATTTCATGCACAGGGATGAGGAG
GTACTCTCTCTCTCTATCTATCTCTACACACACTATTTTAATCGGAAGCTCAGCTAT
TTTACCTTCTGTTTAATTGGATCATTTCTCTCTTCTTCGTCTATGTTGAGGTTATTTTTGTGTCCTTTTGCCTTTGCTTTTAATTTTTGTTCTGATCAATTATCATCGTGTATTCTTCAG

GTCAACTATTTCCCATCAAGGTATGATCCAGTTCGCCATGCTGAGAGTTTCCCCATTCCTCCTGCTGTCTGCAGTGGAAAGCGTGAGAAG
GTAAGTTTTTTCCCTCTTCTTTGTCTTATT
TTTTTGAGCCCACTGCTAAAACGAAATTGTCTAGTGTTCTTGTGTGTGTGAGTTTGGGGTTCTTGTTACGTTTTTCAGAGCAATAATAGGACTAGTGGGATTGGAAAGCTATTGTATGAT
CCTATAGAGCTGTGGGTTAAATTGATGGGCTGTTAATATGATCGGAGATATATTTATTAGCACATAATTTATCAGCCTTTGCTGGTTATTGCAGTGCATCATTGAGAAGGAGAACAACTT
CAAGCAACCTGGAGAGAGATACCGATCCTGGGCACCAGACAG
GTAAACCATAGTTCTGCGAGTACTTTACAATGATTAATTATATGACTGATCCTTCATGCTCTTTCCTTATCTTTTCTT
CCCTCTATCTTTTTGTACAGGCAAGAACGATTTATTTGCCGATGGGTTGATGCCTTATCTGACCCACGCGTCACACATGAGATTCGCAGCATCTGGATCTCGTACTGGTCTCAGGTAAGA
CTCCCTTTGGAATTATGCAGTGTCATGTTCATACTGGATCGCATATAAATGTTTTGATTCTAAATCCATTACTGGCAATGATGCGATGCAGGCTGATAAATCTTTGGGTCAGAAGCTAGC
ATCTCGTCTCAACGTGAGACCAAGCATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGTACCGTCCATCAAGCGCTTTCGGTACTCCATACTGGACTACAAATTCTGGAGCTCCGGTTTGGAACAACAACTCGTCTTTGACCGTTGGATCTAGAGGTCCAATC
CTCCTTGAGGATTACCATCTGGTGGAGAAGCTTGCCAATTTTGACAGGGAGAGGATTCCAGAGCGTGTTGTCCATGCTAGGGGAGCCAGTGCAAAGGGTTTCTTTGAGGTTACCCATGAT
ATCTCTGGCCTCACATGTGCTGATTTTCTCCGGGCTCCTGGAGTTCAGACACCTGTCATTGTCCGCTTCTCCACAGTTATCCATGAGCGTGGCAGCCCTGAAACCCTGAGGGATCCACGT
GGATTTGCAGTGAAGTTTTACACCAGAGAG
GGTAACTTTGATCTCGTGGGAAACAATTTCCCTGTCTTCTTCATCCGTGATGGAATGAAATTCCCAGACATGGTGCATGCCCTTAAGCCC
AACCCTAAGTCTCATATTCAGGAGAACTGGAGGATTCTTGACTTCTTCTCCCACCATCCTGAAAGTTTGCACATGTTCTCCTTCCTATTTGATGATTTGGGTGTTCCACAAGATTATAGA
CATATGGAAGGCTCTGGTGTTAACACCTACATGTTGATCAACAAGGCTGGAAAAGCCCATTATGTGAAATTTCATTGGAAACCTACTTGTGGTGTGAAATGTTTGTTGGAGGATGAGGCA
GTTAAAGTAGGAGGCACAAATCACAGTCATGCTACTCAGGATCTATATGACTCCATTGCAGCTGGCACCTATCCTGAGTGGAAACTTTTCATCCAGACAATTGATCCTGACCATGAAGCC
AGGTTTGATTTTGACCCACTTGATGTAACCAAGACCTGGCCTGAGGATATCTTGCCCCTGCAGCCAGTTGGTCGCTTGGTCTTGAATAAGAACATCGACAACTTCTTTGCTGAAAATGAG
CAGCTTGCTTTCTGCCCTGCTATTGTGGTTCCTGGTGTTTACTATTCAGATGACAAGCTACTCCAGACTCGAATCTTCTCCTATGCTGATACCCAGAGGCACCGTCTTGGACCAAACTAT
CTGCAGCTCCCTGCTAATGCTCCCAAGTGTGCTCATCATAACAATCACCATGAAGGTTTCATGAATTTCATGCACAGGGATGAGGAG
GTCAACTATTTCCCATCAAGGTATGATCCAGTT
CGCCATGCTGAGAGTTTCCCCATTCCTCCTGCTGTCTGCAGTGGAAAGCGTGAGAAG
TGCATCATTGAGAAGGAGAACAACTTCAAGCAACCTGGAGAGAGATACCGATCCTGGGCACCA
GACAG
GCAAGAACGATTTATTTGCCGATGGGTTGATGCCTTATCTGACCCACGCGTCACACATGAGATTCGCAGCATCTGGATCTCGTACTGGTCTCAGGCTGATAAATCTTTGGGTCAG
AAGCTAGCATCTCGTCTCAACGTGAGACCAAGCATTTGA

Retrieve as FASTA