Entry information : VvAPx-R (GSVIVT01035858001)
Entry ID 5173
Creation 2009-02-27 (Christophe Dunand)
Last sequence changes 2011-07-28 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: VvAPx-R (GSVIVT01035858001)
Name (synonym) VvAPx-R (GSVIVT01035858001)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Vitaceae Vitis
Organism Vitis vinifera (Grape)    [TaxId: 29760 ]
Cellular localisation N/D
Tissue types Berries
Leaves
Petioles
Inducers Bacterium infection
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value VvAPx-R
start..stop
S start..stop
CclAPx-R 463 2e-165 22..330 27..335
CsAPx-R 462 5e-165 22..330 27..335
RcAPx-R 454 3e-162 10..330 3..328
PtAPx-R 451 6e-161 22..330 27..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4950314..4950476 163 N° 2 4949347..4949461 115 N° 3 4948640..4948767 128 N° 4 4947354..4947424 71
N° 5 4947125..4947167 43 N° 6 4946935..4947031 97 N° 7 4946577..4946660 84 N° 8 4943714..4943835 122
N° 9 4943271..4943337 67 N° 10 4942548..4942650 103  
complement(join(4942548..4942650,4943271..4943337,4943714..4943835,4946577..4946 660,4946935..4947031,4947125..4947167,4947354..4947424,4948640..4948767,4949347. .4949461,4950314..4950476))


exon

Literature and cross-references VvAPx-R (GSVIVT01035858001)
Literature REFERENCE 1 Goes da Silva,F., Lim,H., Iandolino,A., Baek,J., Leslie,A., Xu,J., Jones,K., Walker,M.A. and Cook,D.R. Transcriptional responses of Vitis vinifera to infection by the bacterial pathogen Xylella fastidiosa.
REFERENCE 2 Velasco,R., et al.,The first genome sequence of an elite grapevine cultivar (Pinot noir Vitis vinifera L.): coping with a highly heterozygous genome
DNA ref. Phytozome 12:   chr4 (4950476..4942548)
Cluster/Prediction ref. UniGene:   Vvi.7193
Protein sequence: VvAPx-R (GSVIVT01035858001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   35908.15  
PI (pH):   %s   6.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASYGFDHSLLCPLSPFSCSGKFKFPAKTPLSTVEFCAKASKSSSVATTAIEDSNQPCFDVSYGRRELILIATLPFLLPVHESMQKFGVKAAELGTTEYLLMKEEVRKVLSKGKAAGVLRLVFHDAGTFEMDDNSGGMNGSIVYELDRPENTGLKKSLKILEKAKSGVDMVQPVSWADMIAVAGAEAVSVCGGPKIPVQLGRLDSMAPDPEGKLPEESLDASALKQCFQRKGLATQELVALSGAHTLGGKGFGNPTVFDNSYFKILLEKPWKSSDGMSSMIGLPSDRALVEDDECLRWITKYANNQNMFFEDFKNAYIKLVNSGARWKNL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 19, 9 introns) and 7 ESTs. Cultivar="Cabernet Sauvignon", "PN40024" and "Pinot Noir".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTATGGCTTTGACCACTCTCTCCTTTGCCCACTCTCCCCATTCTCCTGCTCCGGCAAATTCAAATTTCCCGCCAAAACTCCACTCTCAACTGTCGAATTTTGTGCCAAAGCC
TCCAAGTCTTCCTCCGTCGCCACCACCGCCATCGAAGATTCGA
GTAAACACTATCCCTTTTGGTTTCTACATACTGTGTTTGGCTGCCGAGAAAATCGAAGAAAATTAATAATTCATACT
TTTGTTTTACCTTTTCTCAGCCACCAAACTGGTTGTTAACGTTGTTTGGTTTTAAAATTTGAATCTCATTTTATGTGTTGGTTTGGCTTTGTGATGCAAGTCAGCCAAATAGTTGTATGA
TTGTATTAGACATGGTTAAATGGAGTCTTTTGAATAAAATAAAATATTTAAGATTTAGTGTTTTCTTTTCTTTTCTTTTTTCCTGCTTTTTCTTAGCAAACGATTAAGGCATTTATTAAA
TTGTTTGCCTTCTCAATGGAATTTTTATGAAAAAATATTCTCAATCCCAGCTGCATACTTCTTAAAATGATTTGAACTTCAGAAATAGTCAGACAATGTCTCAAGTGGAAAAATTGTCCC
TTCTAATTTTTACCTTGTTGGGGTTAGTTTTCCCTTATATTCTGTTGGTTCCAGAGAAAACTCTGGAGGATAAATTTTGAGTTTTAGGTTTTGGTTGTTGAGTTTCTTATGAAAAGGAAA
ACCTCTTTGTGAGCCAAATAATGATACAATGTGTAATGGGTGATTGTTTCCTTCCTTTTGGTTTCTCAGCAACTAACATGACATTGTTTCAATTATTTGTATTTTTTCTGAAACATTCTT
CCTTTTCTATGCTCACATTCTTGGGTCAGTTTGGAGTTTTAAACATAGTGGGTTGATTATAAGAACTTGTTAGGGTTTCTGAATTTGCCATTTTAGATTCTTCATCATGAAATAGGAAAA
TAAAGATCTTCATTTTGACTTGTGTATTTATTGTGTTTGTTTTATTTGATCACAGATCAACCCTGCTTTGATGTTTCATATGGACGAAGGGAACTTATACTCATAGCCACACTACCATTT
CTTCTTCCCGTGCACGAGTCTATGCAGAAATTTGGTGTAAAGGCTGCAGA
GTAAAAATTAAAGAAAATCCTGCTTTTCCCAAATTTTATTACTTCAGTTTGAATAATGGCTTAATTTGAA
TGAGAAACAAGTTATTTATTTACTGTTATAGATGGCTCAAATAGATGTATGAAATATCACTTCCTTGGTGTTACTTAAAGTAATTCCACTGGTCAAACGGCTATAGTTTGTAAAGGCTTT
TATGAGCACCCTTTGCTGTGGGCTTATGGGAGCTCCCTCAAAAATTGGTCTTAGTGCCATAATCTAATCCACATACCACATCATGATGTCAGACCTGGCTCTAGGTGTTCAAATTTTACA
TTTGGGACCAACTCGTGGTCCTTAAATGATACCACGGTCTCCATTAAGAACTATGCCAAAATCATGCTGATGAAAGTGAAAGCTTGTAGTGTGACCATGGAAGCACCCTCATGGTAGCCT
CCTCCTCTCTCATTATTGCCTACTTGCTTTTGTTTGTGTGTGTGCGCACGCATACATGTGTGTCATGTGGAGGGTGGGATGCATTAGGTTTACAATTGTAGGCATTTTGTGTTACTTCAT
CAACTTCTTTTCCTGAATTGACATTGTAGGTTAGGTACTACTGAATATCTGCTAATGAAAGAGGAGGTAAGGAAGGTTTTGTCGAAGGGCAAGGCTGCTGGTGTACTTCGCCTTGTTTTT
CATGATGCTGGGACCTTTGAAATGGATGATAATTCAG
GTACTTCTTTGGTGGTAATGATGTTGGGAAAAGATGCTGATGTTATGATAATATGTTTGATGCTTATGTTATCATATACTTGG
TGTGGCCTGCCTTTAAAACACTTTATTCATTTTAATTTAAATCCTTTGTCTTGTTAGTCTTAACTGTTGGACCTAGTTTGTTTGCATTAAAAATTTCAATTTGGCATTCAGGCTAAGTTG
GTTGATCTGAACTTGCATCATATTATATAGGTTCTTTAAATTTCAAGAACTTGAAACACCCAATAAATAATTGATGAATTTCCTGGATTTCATGATGTCAGACTAGCCACAACATCTAAC
CATGAAAGAAACAAAGAAAATAGGGCAAACAATCTTACAAATAAACAAGACTTTTGTTATTCAGCGGTGCATATACATCCTTGGATGGTAGGAGAACAAATTTACTATCTTTGAGAATTA
GGATTGTTAGAGTCTCTCACCTCTCCTCTCACTTTTTGACTTCCTTCATTTGCTAAGTACTAGAAGATCCTCAATGGGACTCTGGTCAATGCATCAAACTGGATCAATTAATCCATTTCT
TCATGGTATGTGACACTGTAATCTTGTTGGTGTCTTACATTCATGGAGGCTGTGGTGGCATTCACCTGCCCAATGACATATTGTGTTTTGCCTTCTTGTCTATGTGCTACTTTAATACCT
CCCATATGGCACTAGGTGCAATTCTTAAACTAGCCTGACATCCCTGGACATATCTCTTCTAGTTACCACCAATCAAGGCTAGTGAAGTGAAGGTGGCAAAGACCTATGTGAGCGTTATTG
AAAAGGCCCCTTACTATGAATAGGTTATTTAAATAGGGTATTAGAGGCTTATTAATAACAAAGAAAGATTTTCTACAATCTTAAGCAGGCTAATTGCCATTAAACTACAAGATCTTATTT
CAGTTGTCTCATAGAGGCACTGAATGGGAGTGCCTATTAATCATGAGTCATGACTCTCATTGATGCAAAGCCGTGGTAATAACTGATTGTGGGACAAAGAGCACTGAACTTTTTGTGGTT
GAAATGTTTCCAAATCAAAATTGTGATATAAGATTTCATGTTCCATTTTTTTTATGTTTCATATTTCTATTGGTTCTTAGTCCAATTATTATTTGCAGTTCATCTTTTGTCAAATTTCTA
TTCATTTTCTTGTTCCGTTGTCTAGTGATCTGCTCTGTTATTTCCTCTGCAGGTGGCATGAATGGTTCCATTGTGTATGAACTTGATAGACCAGAAAACACAGGTCTAAAAAAATCTTTG
AAG
GCATGCTCTATGATAAACCTTTTGTTTTTTATGCACATAATTTGTGTCCACATGCATCCAGCCATCTCAGTATTTTTCTTTTCTCATGTTTCAAAGTTCTAAAATTACTTGAACATA
TATCCAGACTGGTCAACTTTTATAGGATCTCCTACCAGCTAACTCCTAGGTGGATGCATTGTTGTTTAGATTCTAGAGAAAGCGAAGAGTGGAGTGGATATGGTACAACCAGGTTGTTGT
TTTCTGCAATGGCATCGTTAAATCGTCTTAATGTTAATGGATGATGCAATCAGAAGCTAACTTCTTATGTTTGCTCCTTAATTAGTATCATGGGCAGACATGATTGCTGTGGCTGGAGCT
GAAGCAGTTTCAGTATGCGGTGGTCCAAAAATCCCAGTTCAGTTAGGCAGATTAGACTCAAT
GTAAGGGGCAACCTTTTAACATACAATTTGACAAGGAATACAACTTACTTAGCTCAAT
TAAACTGGGTATCTTAAGATGGTATATGTAAATAATCCTCAAACTTGAGCTTTGAATGCGTATTGGAGTTATTAACCAAGCATGGCTAATTTTGGTGGAAAAACTGTCAAAATTTCTCTC
TATCAGCCCTGCAAAGTTGCTACTCAACATTATAGAACTTTGAAGAAAAAAACATGGAGTTCATATCTTAAGTAACTACTTTTGTTTTCCTTATAGGGCACCTGATCCTGAAGGGAAACT
TCCTGAAGAATCTTTGGATGCTTCTGCCTTGAAGCAATGCTTTCAAAGAAAAGGCTTAGC
GTGAGTTCACATATTTAACATATATTCTTAATTCACATGTTTGACATATAAAAGCTGTTT
AATAAATTTTTCTCTTGTTTTTATAATGAGCTCAATTAGAATTGCTATAAATAGTAGTATCCTAGTGTTCCCAACCAGATCTTATGCCCCCATACAAAATAATTTTGTTGTAGAACACTG
ATGTTAATGATTTAGAAACTCTTCTTTATTATTAGATGAAGGCTATCATTTTTATCATTATCTTTTTAGATTATAAAACTGTGGCTTCCTGATTCTCTTGTTGTTACTTCATTTTTTTCT
ACTTACCCACTATAATTCTAGCACCTGCATGCTGTCAAGTGATTGGTTCTTATTTCTTATATCATGGTTTGACTCATTTATTTCTGGAATGGACCTGACATTTATTTCTTGAGATCTGAA
TAGATCATTTGGAAAATAGTATAATACCTCCAGCAGTATCAGTTGTGCGATGTTTGAATGCCAATCTCAATTGTTGAATTTCAATGATTAGGATAGCTTCACTTTCACGCTATGGTCCAG
GATCCAACCCCTGCCATTTCTCCAAGCATGAAGGAGGAAGTTAAGCATTTGAGAAGTTCTATGGTATCGAAGTGGTATGATACCTCCAACAATCTCAGCCATTCGATGTTTTAACATCAA
TCTCGACTGTTAGAATTAATGACTAGGTTTAACTCACCTTCATCATGGTCTATGGTAAGGAGGTATTGTACTTCCACTGTGTGGTAGCATGACCCTAAGCATTTCTAAGAGCTTGTATAG
TTAGCTTTTTAATAGAAGCATGAAAACTCTCATTTTTATGTTTGGTCTTTAAGCTTCAGCATTGTTATCCACTTTCTTTGACAGCCTCCATTTCCACACATAAAGAATGGAAAATGATCT
CTTTAAACTTCAGGGTAAGAACCTTCATGTAAAATATTCTTCTGTTCATGTCTCTTCAAATGCTCCAGGCCACACAAATGGGGGGTTTCCTCCATTTCTTCCTTTCCTTTTGAGTAAATT
GTGAAGCCACACCATCTTCATTTCTCCCTATTCTCCAATAACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGATAGGTATTCTTTTGGTGGATGGCTGAGTTGTATATTTATTC
CACAAGTGCTGCATTAAAATTAAGGTGTTTTTGTAATGCCTATATCTAAGCTATATTGCTTACTAATCGGTGAAACCATATCAAATTGTTTGTTACATGCTGCAGTACTGTGCCCATGAT
GTTTAAGATATGTAGGTTTGGCAATTCTGACTCTTAGATTCATACATGCACTCAAAGATCTGCACCAATGTAGCATAGTTTAGAAATTATGACTACTAGAAACCAGTATGGTGGTTAGTG
AGTTGTATATATGAATGAAACCTGTCTAGTCTGTCAGAAACCAGTATGGTGGTTAGAGGTCTTATGTCTCAGGCATGTTTTTCCATAATTAACTTGTCAGAGATATCTTGTTTTTAGACT
TACATGCATGATGCTGTGGTTTTTTTTTTTTTTTTTGGCAGAACACAAGAACTTGTTGCATTATCTGGAGCTCATACTCTTGGAGGTAAAGGTTTTGGAAATCCCACTGTTTTTGACAAC
TCATATTTCAAGATACTTCTGGAGAAGCCATGGAAGTCTTCAG
GTGAATAATGTAATTTGCTTGTCATTATATCAAAGAAATGTCTTGGAAATATGCTGGTCAAAGGGACTTATAGGAGC
AGTATTGGTTCTACTAGCTGCCTGCTGAAAAAGGAATTTTGATAAATGATATAATTGGAACAGGGGAAGCAAGATAGTGATTTGGAAAGCCAGGAGAGAACTCCAATACTTATGTTTGTT
CAAGTGAAAAATGCTGCTTTCTTTGTCTAAAAATAGTGGCCATTTACCTTATCAGTTTTGCTGTCTCTGATATATTCTGTATGTATCCGCCTACAGTATTTCAAGTGCATCAGTTTGCTC
TTGTTCTTATCAATTTCTTTGTTTCTCAAATTTCATACGTTGATTCTATTCTGATGCAGATGGTATGTCAAGTATGATCGGGCTTCCTTCAGACCGTGCACTTGTTGAGGATGATGAATG
CTTGAG
GTTGTTCATCTTCAAAAACCTTCTAAACTTGCCCTTACTCATGCATCATGATATTTTCTTTTCCCTTTTTCTAAGCCCTCTGATTGGGGTGGAAAGAAAAATTCTGAAGCATGC
ACAGTTCCATATAAATCATTTGATTGGTTCCCACTTAAGATGTCCCTTTAATTACTAAGCATGGTTGCGGATAATCCAAGGAAGTAAATGGAATAGGTTAATACTTCTGATCAGGGCTCC
TCTTTTTGTGTGTGTGGACAAAATTATATGATTTGATCATGGTAAGGTTGACTGCAGTTTCCTGACTAAGAATGCCATTGCTTTTTGTCTGCCCAACCAAAGTCATTCTTGGAAGTGTCC
CAATTTATTGAGAATTTCCTCCCGATTAACTGAAGCTTTCCCAGCTTTCCCAGCTTTGAGTAACTCATGAATCCAAATTTGTTTGTATAATGAGCCTGATGCGGATGGCCCAACACAATG
ATTACATGTGTAGAGTGTTCCATAGTGGGATTCATGGTGGCTTCCTGCTGATATAATTCCTAAGTAATCTCATTTTACTTTTAGAATATTCATGTTGGCCCATTTATCTTTGTTTCTCAA
CTAAAAGCAACTTATATTATGGACAGATGGATCACAAAGTACGCCAACAATCAGAACATGTTTTTCGAAGATTTCAAGAATGCCTACATCAAACTTGTGAATTCTGGTGCAAGGTGGAAG
AATTTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTATGGCTTTGACCACTCTCTCCTTTGCCCACTCTCCCCATTCTCCTGCTCCGGCAAATTCAAATTTCCCGCCAAAACTCCACTCTCAACTGTCGAATTTTGTGCCAAAGCC
TCCAAGTCTTCCTCCGTCGCCACCACCGCCATCGAAGATTCGA
ATCAACCCTGCTTTGATGTTTCATATGGACGAAGGGAACTTATACTCATAGCCACACTACCATTTCTTCTTCCCGTG
CACGAGTCTATGCAGAAATTTGGTGTAAAGGCTGCAGA
GTTAGGTACTACTGAATATCTGCTAATGAAAGAGGAGGTAAGGAAGGTTTTGTCGAAGGGCAAGGCTGCTGGTGTACTTCGC
CTTGTTTTTCATGATGCTGGGACCTTTGAAATGGATGATAATTCAG
GTGGCATGAATGGTTCCATTGTGTATGAACTTGATAGACCAGAAAACACAGGTCTAAAAAAATCTTTGAAGATT
CTAGAGAAAGCGAAGAGTGGAGTGGATATGGTACAACCAG
TATCATGGGCAGACATGATTGCTGTGGCTGGAGCTGAAGCAGTTTCAGTATGCGGTGGTCCAAAAATCCCAGTTCAGTTA
GGCAGATTAGACTCAAT
GGCACCTGATCCTGAAGGGAAACTTCCTGAAGAATCTTTGGATGCTTCTGCCTTGAAGCAATGCTTTCAAAGAAAAGGCTTAGCAACACAAGAACTTGTTGCA
TTATCTGGAGCTCATACTCTTGGAGGTAAAGGTTTTGGAAATCCCACTGTTTTTGACAACTCATATTTCAAGATACTTCTGGAGAAGCCATGGAAGTCTTCAG
ATGGTATGTCAAGTATG
ATCGGGCTTCCTTCAGACCGTGCACTTGTTGAGGATGATGAATGCTTGAG
ATGGATCACAAAGTACGCCAACAATCAGAACATGTTTTTCGAAGATTTCAAGAATGCCTACATCAAACTT
GTGAATTCTGGTGCAAGGTGGAAGAATTTATGA

Retrieve as FASTA