Entry information : SbAPx-R (Sobic.007G205600.1 [2.1] / Sb07g027300 [1.4])
Entry ID 5185
Creation 2007-04-13 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbAPx-R (Sobic.007G205600.1 [2.1] / Sb07g027300 [1.4])
Name (synonym) SbAPx-R (Sobic.007G205600.1 [2.1] / Sb07g027300 [1.4])
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation Cytosolic
Tissue types Leaves
Roots
Inducers Drought
Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx-R
start..stop
S start..stop
ZmAPx-R 560 0 1..333 1..337
SiAPx-R 552 0 1..333 1..334
ObrAPx-R 503 0 1..333 1..331
BdiAPx-R 484 6e-174 1..333 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62400824..62400906 83 N° 2 62400622..62400734 113 N° 3 62400334..62400424 91 N° 4 62399949..62400076 128
N° 5 62399544..62399614 71 N° 6 62399360..62399402 43 N° 7 62399165..62399261 97 N° 8 62398954..62399037 84
N° 9 62398621..62398742 122 N° 10 62398395..62398461 67 N° 11 62398138..62398240 103  
complement(join(62398138..62398240,62398395..62398461,62398621..62398742,6239895 4..62399037,62399165..62399261,62399360..62399402,62399544..62399614,62399949..6 2400076,62400334..62400424,62400622..62400734,62400824..62400906))


exon

Literature and cross-references SbAPx-R (Sobic.007G205600.1 [2.1] / Sb07g027300 [1.4])
Literature Cordonnier-Pratt,M.-M., Zhang,D., McCartor,K., Nguyen,H.T. and Pratt,L.H.. An EST Database from Sorghum: Subtracted post-flowering drought stressed leaf tissues
DNA ref. Phytozome 12:   chromosome_7 (62400906..62398138)
Cluster/Prediction ref. UniGene:   Sbi.7749
Protein sequence: SbAPx-R (Sobic.007G205600.1 [2.1] / Sb07g027300 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333
PWM (Da):   %s   36138.56  
PI (pH):   %s   7.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELTNIPYIASSSSSSCFYYSYSRCGCRVRRDGKLVIKASIAGSKHAADSVCSQLFEQETEDPLVARSSWHIRRRDLASAILLPFLLPRVNISIAAEIYDASIIRSGVRNILTKAKAAGVLRLVFHDAGTFEIGGKGGMNGSIIYEVDRPENTGLNRSIKILTKAKEGIDNVQVSWADLIAVAGAEAVALCGGPEIPVRLGRLDSSTADPTGKLPEETLDATSLKTLFNKKGFSAQEMVVLSGAHTIGGKGFGSPIVFDNTYFKVLLEKPQTSTGMAAMVGLRTDWALTEDDECLRWIRVYAEDQARFFDDFRDAYIKLVDSGASWRTA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 10 introns) and 6 ESTs. Cultivar="B35" and "BTx623".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACCAACATCCCCTATATTGCGTCATCTTCCTCGTCCAGCTGCTTCTACTACAGCTACAGTCGCTGTGGCTGCAGGTGATGTTAGAGAACTCTCATTCCCGTATGCAAATGA
TGCAGTCTTTGTCTGAATGGAAACAAATAACCTGAGAAATCATTACTTGCAGAGTTAGAAGAGATGGGAAGCTGGTAATAAAAGCTTCTATAGCTGGTAGTAAGCATGCTGCTGATTCAG
TATGTTCACAACTTTTTGAGCAGGAAACTGAAGATCCCCTTTCAG
GTAGACATTGCAGTTCTTATGCTTTGTGTTTCAGTTAGAAACTTAGAACCTCATATCACTTGGTTCCAAATCATT
TTCGCTGAAGCTGTAACTATTTGAATTACAATGGGAAACTTTTGTTGCTTGGGCTGATGCCAGAGCCAGGCCATGGAAATTAGTATGGTCAACTCAAAGTTTCTCTTCTGTGGTGGCTGC
AGTTGCTAGATCTTCCTGGCATATAAGAAGGAGAGACTTGGCTTCTGCCATTTTACTCCCTTTTCTGCTTCCTCGTGTTAACATCTCCATCGCGTAAGTGCATTATTATCACTGAATTTA
GCCGTTCATCTCCTAACATTATGAATCGACATTCAAAAGAGCATCTTCTTGATGTTTCAAATGGAAAATACTGCTTGAACATGGATTTAGAAGGAGAAGCATGTAATGAGCCATAGTTGA
ATCTAGTAAACTTGGAACAATGATCTAGTAAAGGAAAGATCCTTAAAGCTGTTTCTTGCTCCTAAAACAATAGTGTTATTTATAAAGAAGTTATCTGGTTGATTTCACAGGGCTGAGATA
TATGATGCATCAATTATTCGAAGTGGTGTTAGGAATATTTTAACCAAGGCCAAGGCTGCTGGTGTGCTTCGATTGGTTTTCCATGATGCAGGGACTTTCGAAATTGGTGGCAAATCAG
GT
TAGTCTCTTAATACCATGGTCGATTTCAGGTTGCTGTAGTACACTATCAAATTCTTTGGACTAAGAAAACTGATAGGTTTTTTAGTAGCATTTGTATAAGGAAAATTCTTAATATAATGA
TACACAGCTCTCCTGTGTGTTCAAGAGCAAAAGCATTTGTCTATGTAAATGATGCAAAATGGTATTGTTAAGGAGATATAATTTTTTTTTTGTAAAAGGAAAGAAATAACAACATTTGTG
GTGCATACACTGATTGCTACCTCACTGCTATATTAGTTCAGCAAAGAGACATATTTGCCTTTCCTCAGACTACTAATATTGATAACTTTCAGGTGGCATGAATGGCTCTATAATTTATGA
AGTTGACAGACCTGAAAATACTGGGCTAAATAGATCCATAAAG
GTTCCACCCCTCCCCTCTTGAGTGCATTTGGGGCAATAAATTGCTTTATATCTACTTATTTTTCTGAATAATATCAT
ATATCCTTCTTGATAATATCTTCCCTTCAGTTGATGTCTATTTAATTGCCTCATAATTGAACAGATACTAACAAAAGCAAAAGAAGGAATTGACAACGTTCAGAAAGGTATGCAGATTAT
GCCGTTTGCTGCCTTGCACTTTCTTTATGAACTCCAGTTTGGGTGTATTCACATAAGTCTAATTTCCTGCTGTTTGTGCTGACAGTGTCATGGGCGGATTTGATTGCCGTGGCTGGTGCT
GAGGCTGTTGCGCTCTGTGGTGGGCCTGAGATTCCAGTAAGGCTAGGAAGATTAGATTCTAG
GTGAGACATCACAGTGAGTTTTTATTTTACTACTTTAACCTAAATTTTTTTAAGAAAT
ATATATATTCCAGATTGTGTTTTGTCTTTCTACCAGTAGTTTTCTGAAGAACACAATTCTTTTATGCAGCACTGCTGATCCAACTGGTAAACTTCCTGAAGAAACATTGGATGCAACTTC
CTTAAAAACATTATTCAACAAGAAGGGCTTTTC
GTGAGTTGTCTTTTTTATGAAATTATTATATATATTTTGTGAATTCCAGTTCTTAATTTTGGTCTACTCCTATTTTGCGGACCTCAC
CTCCTCTGACCTGGCAATATTTGAGCAGATTTTATGTTTAATCCCTGTGGCTTCTAGCCATTGCTCCATAAAGCAGGCTGTGTTAATTAGACCTATGTCTAAAGTTATGTTTGGTACTTA
ACAGGGCGCAGGAGATGGTTGTTTTATCTGGAGCGCACACAATTGGAGGTAAAGGATTCGGGAGTCCAATTGTTTTCGATAACACCTATTTCAAGGTGCTCCTTGAGAAGCCGCAAACAT
CTTCGA
GTAAGTGCATGTCCTTACCAATTGTTTCGATTCTGTTTTTCTGTCTCCCTTGGATTTTCAAGACGACTTGTCCATCATAGCCCATTCGATGTTTATGTGCTTATCAAAACACAA
AACTTACTGTGTGGGCTTATGAGCTTATCGTGTCCCTTTGTGAAGCTGGCATGGCGGCAATGGTTGGGCTGCGCACGGACTGGGCACTCACCGAAGATGACGAGTGCTTAAGGTAGTTTT
ATGAAATGTGAACTACATCGGCTTTCCTCAATAACATCTCTTTTCCTCGAGTACTTATGTTCTGTAAGAAAATGTACTTAGCACGTTGCTACACGGAATTAGATGGGCCAACAAAATGCT
AAATGTTGCATAATTGAAATCTGCAGATGGATCAGGGTCTATGCAGAGGACCAAGCTAGATTTTTCGATGACTTCAGGGATGCATACATCAAGCTCGTAGACAGTGGAGCCTCGTGGAGA
ACAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACCAACATCCCCTATATTGCGTCATCTTCCTCGTCCAGCTGCTTCTACTACAGCTACAGTCGCTGTGGCTGCAGAGTTAGAAGAGATGGGAAGCTGGTAATAAAAGCTTCT
ATAGCTGGTAGTAAGCATGCTGCTGATTCAGTATGTTCACAACTTTTTGAGCAGGAAACTGAAGATCCCCTTTCAG
TTGCTAGATCTTCCTGGCATATAAGAAGGAGAGACTTGGCTTCT
GCCATTTTACTCCCTTTTCTGCTTCCTCGTGTTAACATCTCCATCGC
GGCTGAGATATATGATGCATCAATTATTCGAAGTGGTGTTAGGAATATTTTAACCAAGGCCAAGGCTGCTGGT
GTGCTTCGATTGGTTTTCCATGATGCAGGGACTTTCGAAATTGGTGGCAAATCAG
GTGGCATGAATGGCTCTATAATTTATGAAGTTGACAGACCTGAAAATACTGGGCTAAATAGATCC
ATAAAG
ATACTAACAAAAGCAAAAGAAGGAATTGACAACGTTCAGAAAGTGTCATGGGCGGATTTGATTGCCGTGGCTGGTGCTGAGGCTGTTGCGCTCTGTGGTGGGCCTGAGATTCCA
GTAAGGCTAGGAAGATTAGATTCTAG
CACTGCTGATCCAACTGGTAAACTTCCTGAAGAAACATTGGATGCAACTTCCTTAAAAACATTATTCAACAAGAAGGGCTTTTCGGCGCAGGAG
ATGGTTGTTTTATCTGGAGCGCACACAATTGGAGGTAAAGGATTCGGGAGTCCAATTGTTTTCGATAACACCTATTTCAAGGTGCTCCTTGAGAAGCCGCAAACATCTTCGA
CTGGCATG
GCGGCAATGGTTGGGCTGCGCACGGACTGGGCACTCACCGAAGATGACGAGTGCTTAAG
ATGGATCAGGGTCTATGCAGAGGACCAAGCTAGATTTTTCGATGACTTCAGGGATGCATAC
ATCAAGCTCGTAGACAGTGGAGCCTCGTGGAGAACAGCTTAA

Retrieve as FASTA