Entry information : PtAPx-R (POPTR_0006s27060 / Potri.006G254500)
Entry ID 5192
Creation 2007-04-13 (Christophe Dunand)
Last sequence changes 2007-04-13 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtAPx-R (POPTR_0006s27060 / Potri.006G254500)
Name (synonym) PtAPx-R (POPTR_0006s27060 / Potri.006G254500)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtAPx-R
start..stop
S start..stop
RcAPx-R 495 3e-178 27..337 19..328
MeAPx-R 489 6e-176 1..337 1..335
CclAPx-R 473 3e-169 27..337 27..335
CsAPx-R 468 2e-167 27..337 27..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25949554..25949737 184 N° 2 25949299..25949413 115 N° 3 25948809..25948936 128 N° 4 25948653..25948723 71
N° 5 25948407..25948449 43 N° 6 25948219..25948315 97 N° 7 25947904..25947987 84 N° 8 25947615..25947736 122
N° 9 25947116..25947182 67 N° 10 25946377..25946479 103  
complement(join(25946377..25946479,25947116..25947182,25947615..25947736,2594790 4..25947987,25948219..25948315,25948407..25948449,25948653..25948723,25948809..2 5948936,25949299..25949413,25949554..25949737))


exon

Literature and cross-references PtAPx-R (POPTR_0006s27060 / Potri.006G254500)
Literature Ralph,S., et al., Genomics of hybrid poplar (Populus trichocarpax deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences. Mol. Ecol. 15 (5), 1275-1297 (2006). 16626454
DNA ref. Phytozome 12:   Chr06 (25949737..25946377)
EST ref. GenBank:   CV235026
Omic ref. ePlant:   Potri.006G254500
Protein sequence: PtAPx-R (POPTR_0006s27060 / Potri.006G254500)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337
PWM (Da):   %s   36649.67  
PI (pH):   %s   8.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLTILGTTKPSSLLSSTLSSTSPQEFKFPAKSQRPFSSTVKFRAKPFKACAFPSNNNDNGEKDDCFSTRRSLLVCISTLPFLFGLHEFLEDLSAKALQSDTNTYMLIKEEVRKVVSKGKAAGVLRLVFHDAGTFEMDGNGGMNGSIVYELERPENAGLKKSLILDKAKGEVDAIQQVSWADMIAVAGAEAVSVCGGPTIPVQLGRLDSLEPDAEGKLPRESLDAPGLKQNFKRKGLSTQELVALSGAHTLGSKGFGSPFVFDNSYYKILLEKPWKSGGMSSMIGLPSDHALVEDDECLRWIKKYADNQNMFFDDFKNAYIKLVNSGARWKSL

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and 1 EST .
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTAACTATCCTCGGCACCACCAAACCCTCCTCTCTTCTCTCCTCTACTCTCTCCTCCACTTCTCCTCAAGAATTCAAATTTCCCGCCAAATCACAACGACCCTTTTCCTCA
ACTGTCAAATTTCGGGCCAAGCCCTTCAAAGCCTGCGCTTTTCCCTCCAACAACAATGATAACG
GTTCTGATAATCGTTGCTTAATTATCCTTTTTTCTGCATAAGCAAATTCTCTTCTT
GGTGTTGTTATTTTGTTTTCAAGTGTTTCTTAGTGGATTAATGAATTCAAAATAGAATCTTGATTGAGTTTTATTCTTTTACAGGAGAAAAAGATGATTGCTTTTCAACTAGAAGGAGTT
TACTTGTCTGTATATCAACATTGCCTTTTCTATTTGGTTTGCATGAATTTCTGGAGGATCTTAGCGCTAAAGCATTGCA
GTAAGTTAAATAAACATACCCAGTTGTTGCTTTGGTTTTGG
ATTTGCATTTTCTTTTGTGAATTCTGGATTATTTAGGTATATAACTCTTGTGGCTTCACTAGGTTCCATCATTAGAGGTTGCTTGATGTTGCTACTTAAGTTTGCTAGGTGGGAATTATT
GGGTTTTTGACCAGTGTGAGCACTATCTTCATAGATGATCCTTTAATTTGTCAATGCCACATGCCTATGGATACTTTTACATCAGAAAAAATTGGGTTAGATTATGTAGTGTGTTTTTAT
GTTAATTTAGTGCCTGTCTTTAGATGCTGTACTTGTTGATGTATGGTTTTTATAAGCTTATTCTTTTCATTGACGCTAAAGGTCGGATACAAACACATATATGCTCATAAAGGAAGAAGT
GAGGAAGGTAGTATCCAAAGGCAAGGCTGCTGGTGTACTTCGTCTTGTTTTTCATGATGCAGGAACCTTTGAAATGGATGGGAATTCAG
GTGTTTATTTTGACTAAATGATATTAGTTAA
AAGTTATCAATTTCTGATTCCTTTCTCATTTGTATACCATTAAAATTAATGCAGGCGGGATGAATGGATCAATAGTTTATGAACTTGAAAGGCCTGAAAATGCTGGTTTAAAGAAATCAC
TGAAG
GCATGCACTCAGTCTCTCATGCTGTTCTTGTTATAAACAGAAATTTGAACTTGCAGATGTGTATTTGCAATTATGTTTGCAGATACTTGTTCTATATTAGATTTTTTTGCTTTGG
CTAAATTTCCTTTTATCTAAATCCAGACTGGTCAATCTTAATACGATCTCCTGCCAGCTAACTCCAGAGTGGGTGCATTGTTGTTTAGATTCTTGACAAAGCAAAGGGTGAAGTGGATGC
AATACAACAAG
GTGGTTATCTGAAATGTCACTATTTAATGGCTTCAAGAATAATGGACAGTGTGGGGCCTGGCTCATATGATTTAGATTTTTCCACTATTAGTATCCTGGGCAGACATGA
TAGCTGTGGCGGGAGCAGAAGCAGTTTCAGTTTGTGGAGGTCCAACAATACCTGTTCAGTTAGGCAGACTAGATTCACT
GTAAGAGGCTAGCCTTTAACCTTACTATTTAGCAAATAACA
AGACTTGACTTGAAGTGAACGGGATCATCTTATAGTTCATGAAAATATTTTCTACTAGCCTTGTATTTGAGTTTGAAATTCATGGGAAAAATACTGTTCAATTTAATGTAGAATTTTGTA
AGTAGAAATTTGAGTGTTATCTACTTAAAATTCTTGGCCCACATTGTTAACAGCTGTTTTATCTTTGTAGGGAGCCCGATGCTGAAGGCAAACTTCCTCGAGAATCTTTGGATGCACCTG
GTTTGAAGCAGAACTTTAAAAGAAAAGGCTTATC
GTGGGTTCTTATCCTTTTCCCATAGACTCAATTGTTGTCATATTCTTCCTGGGCTAACTCAATTTGTAGTGAGGAATGTTAGGAAG
ATATTTTCAGCATATTTATCATGCTCAAGTTTCATTTTTACTATCTTGTCTGCGGAAAATATAACTTTCCTTTTTTTGCAGAACACAGGAACTTGTCGCGTTATCTGGAGCGCATACTCT
TGGAAGTAAAGGATTTGGAAGTCCATTTGTTTTTGACAATTCTTACTATAAAATTCTTCTAGAAAAGCCATGGAAATCTTCAG
GTAAAAAAAAGCTAACATGAATATCATTTTTTTACAA
ATTTTCTTAAGACTAGCTGCACTGCATAATCACTGCACAATCTCATATTATCTAGTAATGTCGTGTGACATCTCAGTGCACTGTTGGTTTAAGCCACATGCTTGAGTTGAGTCTATACTA
TTCCGAAATGATAATGTACATGAGGAATTATAAGAAGTTAATAAAACTTAATCCAAAACCATGGAAGATTACTTTTTTCTCACCCAATAATTTTTCAAGCCAAACTTTCTGTTAGATAAA
TCAAAATTGAGACAGAAGTATGAACATCTATTAATCTAATTTGTCCCTTTTTTGCTTCAAAATTTTCTGTTTTCATATTGGCATTTGCGAAACTGATATTTTGATCTGATGCACTTTACA
TGATCTGCTTTATCATTTCTGTTTTTTGAATGTAGGTGGTATGTCAAGCATGATTGGTCTTCCTTCAGATCATGCTCTTGTTGAGGATGATGAATGTTTAAGGTTTGCCATTTTCGAAGA
TCTCTCAATCAAAACATGTTATCTCTTAAGTCTTGTCTGCGTTGTCTCCTTACTTTGCAAGGCAGTTCTGAGTTGTACCCTCGATGAGTGAAGCATATAGCCTAGCCAGGGATAATGAGT
GGTTCGGAATTCAATAACAAGGAACCTAGCAGACGATAGCCATAATAGTTGTGAAAATTCAGACATAATAACACATGCATGTGAAAATGCATTTTATACCTGCTGAAAGACACAAGCATA
ATCAAGACTAAAAAATTAAAGTATTTTACTGAACTACAATTCGACAGTACATCGGAGTTTTTGCAGTCTTTTTACAAAAGCACTGCTATGAACACATGCTATGAAATTCTTATCATGTAA
TGAGCATTTAGTTTGTCATCCAATGCATGTGTTATGGTTTTATGTGGGACATATATCTCTTGTCTTAAAGACATCCAAAGAGACGTGGACATGGATTCTATTTCCTATACTGGTCACAGC
TAACTCTTCAAATAGTTTCTTGCCTTATCTTATACATGCTCAACTTGAACTAAACTTGTTTAACTTTGATATACTGTAGTAGAGATTTGAATTTTGATTACCTTTTCCTTTCATTGCTTA
AACCTGTGTTCTGTGCAGATGGATCAAAAAGTATGCTGACAATCAGAACATGTTCTTCGATGATTTTAAGAACGCATACATCAAACTTGTGAATTCTGGTGCAAGATGGAAAAGCTTGTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTAACTATCCTCGGCACCACCAAACCCTCCTCTCTTCTCTCCTCTACTCTCTCCTCCACTTCTCCTCAAGAATTCAAATTTCCCGCCAAATCACAACGACCCTTTTCCTCA
ACTGTCAAATTTCGGGCCAAGCCCTTCAAAGCCTGCGCTTTTCCCTCCAACAACAATGATAACG
GAGAAAAAGATGATTGCTTTTCAACTAGAAGGAGTTTACTTGTCTGTATATCAACA
TTGCCTTTTCTATTTGGTTTGCATGAATTTCTGGAGGATCTTAGCGCTAAAGCATTGCA
GTCGGATACAAACACATATATGCTCATAAAGGAAGAAGTGAGGAAGGTAGTATCCAAAGGC
AAGGCTGCTGGTGTACTTCGTCTTGTTTTTCATGATGCAGGAACCTTTGAAATGGATGGGAATTCAG
GCGGGATGAATGGATCAATAGTTTATGAACTTGAAAGGCCTGAAAATGCTGGT
TTAAAGAAATCACTGAAG
ATTCTTGACAAAGCAAAGGGTGAAGTGGATGCAATACAACAAGTATCCTGGGCAGACATGATAGCTGTGGCGGGAGCAGAAGCAGTTTCAGTTTGTGGAGGT
CCAACAATACCTGTTCAGTTAGGCAGACTAGATTCACT
GGAGCCCGATGCTGAAGGCAAACTTCCTCGAGAATCTTTGGATGCACCTGGTTTGAAGCAGAACTTTAAAAGAAAAGGCTTA
TC
AACACAGGAACTTGTCGCGTTATCTGGAGCGCATACTCTTGGAAGTAAAGGATTTGGAAGTCCATTTGTTTTTGACAATTCTTACTATAAAATTCTTCTAGAAAAGCCATGGAAATCT
TCAG
GTGGTATGTCAAGCATGATTGGTCTTCCTTCAGATCATGCTCTTGTTGAGGATGATGAATGTTTAAGATGGATCAAAAAGTATGCTGACAATCAGAACATGTTCTTCGATGATTTT
AAGAACGCATACATCAAACTTGTGAATTCTGGTGCAAGATGGAAAAGCTTGTAA

Retrieve as FASTA