Entry information : GzKat01 (GzKatA)
Entry ID 5195
Creation 2007-04-13 (Marcel Zamocky)
Last sequence changes 2007-04-13 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzKat01 (GzKatA)
Name (synonym) GzKat01 (GzKatA)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzKat01
start..stop
S start..stop
NhaeKat01 1240 0 1..738 1..738
CgraKat01 1109 0 11..738 14..742
PtritKat01 1102 0 12..738 15..740
CheKat02_C5 1100 0 1..738 1..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 385002..385220 219 N° 2 384705..384945 241 N° 3 382858..384614 1757  
complement(join(382858..384614,384705..384945,385002..385220))


exon

Literature and cross-references GzKat01 (GzKatA)
Literature Birren,B., Lander,E., Galagan,J., Nusbaum,C., Devon,K., Ma,L.-J.,
Jaffe,D., Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Kleber,M.,
Mauceli,E., Brockman,W., MacCallum,I.A., Young,S., LaButti,K.,
DeCaprio,D., Crawford,M., Koehrsen,M., Engels,R., Montgomery,P.,
Pearson,M., Howarth,C., Larson,L., White,J., O'Leary,S., Kodira,C.,
Zeng,Q., Yandava,C., Alvarado,L., Kistler,C., Xu,J.-R. and Trail,F.
CONSRTM The Broad Institute Genome Sequencing Platform
"Genome Sequence of Fusarium graminearum (Gibberella zeae)."
Unpublished (2007)
Protein ref. UniProtKB_Uniparc:   Q4I8A4
DNA ref. JGI genome:   Supercontig_3.4 (385220..382858)
Cluster/Prediction ref. GenBank:   XM_386730
Protein sequence: GzKat01 (GzKatA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   738
PWM (Da):   %s   82517.21  
PI (pH):   %s   6.17
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTEQVTGAIKHAVMGHKNDKIDQLKANMVEPNENSRITSDYGVKQNNTDQWLRVASEDQTGPSLLEDAFGREKIHRFDHERIPERVVHARGAGAHGTFRLFESAADVTKAGLFTDTSRETPVFVRFSTVLGSRGSADTVRDVRGFAIKFYTQEGNFDIPGNNIPVFFIQDAMKFPDVIHAGKPEPNNEVPQAQTAHNNFWDFMFEHPEATHMHTWAMSDRTIPRSYRMMQGFGVNTYTLVNEKGERRFVKFHWTPELGVHSLVWDEALKLAGQDPDFHRKDLQEAIENGAFPKWKFGIQVLDESQEHDFDFDILDATKVWPEDLIPVRYIGELELNQTVDEYFTQTEQVAFCTSHLVPGIGHSDDPLLQGRNFSYQDTQLSRLGTNWEELPINKPVCPVMNFNRDGAMRHTITKGKVNYWPNRFSHQPPATESEGAYVDYAAKIVGMKQRTLSKKFKDHFTQAQLFYNSLSEIEKSHVQAAYSFELDHCDEAIVYERLTERLGEIDGDLANTIAEMVGGKKPANPKPNAGKKAKNLSQLDFVPETPTIKSRRIAIIIADGYDPVAFNAMYGAIKAQSALPFVIAPRRAPIFSAAEDSSSSKGIFPDHHLEGQRSTMFDAIFVPGGAKSIETLSKNGRALHYIREAFGHLKTIGGTGEAVEFINKAIQLSEVALSSTDGSGVVDSYGVVTLKNASPDTLKEIATVASDAKGFLEKFVYNVSCHRNWQRELDGLSTMVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 4, 2 introns). Strain"PH-1 / NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGAGCAAGTTACAGGAGCTATCAAGCACGCAGTCATGGGTCACAAGAACGACAAGATTGACCAGCTCAAGGCCAACATGGTCGAGCCTAATGAGAACTCCCGAATCACCTCCGAT
TATGGTGTCAAGCAGAACAACACCGATCAATGGCTGCGCGTAGCGAGTGAAGACCAGACTGGTCCCTCGCTGTTGGAAGATGCTTTCGGCCGAGAGAAG
GTATGCCACCAAAACCGAGCA
TTATATCTTGATCTCATTCTAACCTTTCACCAAAGATCCACCGATTTGACCACGAGCGCATCCCCGAGCGTGTTGTCCATGCCCGCGGTGCTGGCGCCCACGGTACCTTTAGACTCTTCG
AGTCAGCCGCCGATGTTACCAAGGCTGGCCTCTTTACCGACACATCTAGGGAAACACCCGTCTTTGTTCGGTTCTCGACTGTTCTTGGAAGTCGCGGCTCTGCCGACACTGTCCGCGATG
TCCGCGGTTTCGCCATCAAGTTCTACACCCAAGAAG
GTTCGTCAACACCAAATCCTTCCACCTAACCAATGCGCAACCCCAATATACTATCCTCTATCCTCTATTCAGAAAGCTAATGAT
TTTCAGGCAACTTCGATATCCCCGGGAACAATATCCCTGTCTTCTTTATCCAGGATGCTATGAAGTTTCCCGATGTTATTCATGCTGGAAAGCCAGAACCAAACAACGAGGTTCCTCAAG
CGCAGACTGCACACAACAACTTCTGGGATTTCATGTTTGAGCACCCAGAGGCGACTCACATGCACACATGGGCCATGTCTGACCGAACAATTCCCCGATCCTACCGCATGATGCAAGGTT
TCGGTGTCAACACCTACACTCTCGTCAACGAGAAGGGCGAGCGCCGGTTTGTCAAGTTCCACTGGACGCCCGAGCTTGGAGTCCACTCACTTGTCTGGGATGAGGCCCTCAAGCTTGCTG
GTCAAGACCCTGACTTCCACCGCAAGGACCTTCAGGAGGCTATCGAGAACGGCGCTTTTCCCAAGTGGAAGTTTGGTATCCAGGTTTTGGACGAGTCTCAGGAGCACGACTTTGACTTTG
ATATCCTCGATGCCACCAAGGTTTGGCCTGAGGACCTCATCCCCGTCCGATACATTGGTGAGCTTGAGCTGAACCAAACAGTCGATGAGTACTTCACCCAGACCGAGCAGGTTGCTTTCT
GCACTAGTCACCTTGTTCCTGGTATTGGACACTCAGACGACCCTCTTCTCCAGGGCCGAAACTTCTCTTACCAAGATACTCAGCTCAGCCGACTGGGAACCAACTGGGAAGAGCTCCCCA
TCAACAAGCCAGTCTGTCCTGTCATGAACTTTAACCGTGATGGTGCCATGCGACACACCATCACCAAGGGCAAGGTCAACTACTGGCCCAACCGTTTCAGTCATCAGCCTCCTGCCACAG
AAAGCGAGGGTGCCTACGTCGATTACGCTGCAAAGATTGTCGGCATGAAGCAGCGAACACTAAGCAAGAAGTTCAAGGACCACTTCACCCAAGCTCAGCTTTTCTACAACTCTCTTTCCG
AGATTGAGAAGTCTCACGTCCAAGCTGCCTACTCCTTTGAGTTGGACCACTGTGACGAAGCTATCGTCTACGAGCGTTTGACGGAACGCCTCGGTGAAATCGATGGCGATCTTGCCAACA
CTATTGCCGAGATGGTTGGTGGCAAGAAGCCTGCCAACCCCAAGCCCAATGCCGGAAAGAAGGCCAAGAACCTGAGCCAACTTGACTTTGTCCCTGAGACTCCTACCATCAAGTCTCGAC
GAATTGCTATCATCATTGCTGACGGCTACGACCCTGTCGCCTTTAACGCGATGTACGGTGCCATCAAGGCTCAGAGCGCTCTCCCCTTTGTCATTGCTCCCCGCCGAGCACCCATCTTCT
CTGCCGCTGAGGATTCATCTTCGTCAAAGGGCATCTTCCCCGACCATCATCTCGAGGGACAGCGTTCTACCATGTTCGACGCCATCTTTGTCCCCGGCGGTGCCAAGTCCATCGAGACTC
TGTCCAAGAATGGCCGTGCCCTGCACTACATTCGCGAAGCCTTTGGTCACCTCAAGACCATTGGCGGCACTGGCGAGGCCGTCGAGTTTATTAACAAGGCGATCCAGCTTTCTGAGGTGG
CTCTGTCCTCTACTGACGGCAGTGGTGTCGTTGACAGCTACGGTGTCGTTACTCTCAAAAATGCTTCGCCTGACACCCTCAAAGAGATTGCCACCGTTGCTTCCGACGCCAAGGGATTCC
TGGAGAAGTTTGTCTACAATGTCAGCTGCCATCGCAACTGGCAGCGAGAGCTGGATGGTCTCAGCACCATGGTGGCGTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGAGCAAGTTACAGGAGCTATCAAGCACGCAGTCATGGGTCACAAGAACGACAAGATTGACCAGCTCAAGGCCAACATGGTCGAGCCTAATGAGAACTCCCGAATCACCTCCGAT
TATGGTGTCAAGCAGAACAACACCGATCAATGGCTGCGCGTAGCGAGTGAAGACCAGACTGGTCCCTCGCTGTTGGAAGATGCTTTCGGCCGAGAGAAG
ATCCACCGATTTGACCACGAG
CGCATCCCCGAGCGTGTTGTCCATGCCCGCGGTGCTGGCGCCCACGGTACCTTTAGACTCTTCGAGTCAGCCGCCGATGTTACCAAGGCTGGCCTCTTTACCGACACATCTAGGGAAACA
CCCGTCTTTGTTCGGTTCTCGACTGTTCTTGGAAGTCGCGGCTCTGCCGACACTGTCCGCGATGTCCGCGGTTTCGCCATCAAGTTCTACACCCAAGAAG
GCAACTTCGATATCCCCGGG
AACAATATCCCTGTCTTCTTTATCCAGGATGCTATGAAGTTTCCCGATGTTATTCATGCTGGAAAGCCAGAACCAAACAACGAGGTTCCTCAAGCGCAGACTGCACACAACAACTTCTGG
GATTTCATGTTTGAGCACCCAGAGGCGACTCACATGCACACATGGGCCATGTCTGACCGAACAATTCCCCGATCCTACCGCATGATGCAAGGTTTCGGTGTCAACACCTACACTCTCGTC
AACGAGAAGGGCGAGCGCCGGTTTGTCAAGTTCCACTGGACGCCCGAGCTTGGAGTCCACTCACTTGTCTGGGATGAGGCCCTCAAGCTTGCTGGTCAAGACCCTGACTTCCACCGCAAG
GACCTTCAGGAGGCTATCGAGAACGGCGCTTTTCCCAAGTGGAAGTTTGGTATCCAGGTTTTGGACGAGTCTCAGGAGCACGACTTTGACTTTGATATCCTCGATGCCACCAAGGTTTGG
CCTGAGGACCTCATCCCCGTCCGATACATTGGTGAGCTTGAGCTGAACCAAACAGTCGATGAGTACTTCACCCAGACCGAGCAGGTTGCTTTCTGCACTAGTCACCTTGTTCCTGGTATT
GGACACTCAGACGACCCTCTTCTCCAGGGCCGAAACTTCTCTTACCAAGATACTCAGCTCAGCCGACTGGGAACCAACTGGGAAGAGCTCCCCATCAACAAGCCAGTCTGTCCTGTCATG
AACTTTAACCGTGATGGTGCCATGCGACACACCATCACCAAGGGCAAGGTCAACTACTGGCCCAACCGTTTCAGTCATCAGCCTCCTGCCACAGAAAGCGAGGGTGCCTACGTCGATTAC
GCTGCAAAGATTGTCGGCATGAAGCAGCGAACACTAAGCAAGAAGTTCAAGGACCACTTCACCCAAGCTCAGCTTTTCTACAACTCTCTTTCCGAGATTGAGAAGTCTCACGTCCAAGCT
GCCTACTCCTTTGAGTTGGACCACTGTGACGAAGCTATCGTCTACGAGCGTTTGACGGAACGCCTCGGTGAAATCGATGGCGATCTTGCCAACACTATTGCCGAGATGGTTGGTGGCAAG
AAGCCTGCCAACCCCAAGCCCAATGCCGGAAAGAAGGCCAAGAACCTGAGCCAACTTGACTTTGTCCCTGAGACTCCTACCATCAAGTCTCGACGAATTGCTATCATCATTGCTGACGGC
TACGACCCTGTCGCCTTTAACGCGATGTACGGTGCCATCAAGGCTCAGAGCGCTCTCCCCTTTGTCATTGCTCCCCGCCGAGCACCCATCTTCTCTGCCGCTGAGGATTCATCTTCGTCA
AAGGGCATCTTCCCCGACCATCATCTCGAGGGACAGCGTTCTACCATGTTCGACGCCATCTTTGTCCCCGGCGGTGCCAAGTCCATCGAGACTCTGTCCAAGAATGGCCGTGCCCTGCAC
TACATTCGCGAAGCCTTTGGTCACCTCAAGACCATTGGCGGCACTGGCGAGGCCGTCGAGTTTATTAACAAGGCGATCCAGCTTTCTGAGGTGGCTCTGTCCTCTACTGACGGCAGTGGT
GTCGTTGACAGCTACGGTGTCGTTACTCTCAAAAATGCTTCGCCTGACACCCTCAAAGAGATTGCCACCGTTGCTTCCGACGCCAAGGGATTCCTGGAGAAGTTTGTCTACAATGTCAGC
TGCCATCGCAACTGGCAGCGAGAGCTGGATGGTCTCAGCACCATGGTGGCGTACTAA

Retrieve as FASTA