Entry information : CgKat01
Entry ID 5200
Creation 2007-04-13 (Marcel Zamocky)
Last sequence changes 2007-04-13 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-24 (Catherine Mathe (Scipio))
Peroxidase information: CgKat01
Name CgKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Chaetomium
Organism Chaetomium globosum    [TaxId: 38033 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgKat01
start..stop
S start..stop
NcKat01 1236 0 1..737 1..736
PanKat01 1234 0 1..737 1..736
CtheKat01 1220 0 1..737 39..776
CgraKat01 1093 0 1..737 1..742
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4591707..4591937 231 N° 2 4591227..4591655 429 N° 3 4589612..4591165 1554  
complement(join(4589612..4591165,4591227..4591655,4591707..4591937))


exon

Literature and cross-references CgKat01
Literature Birren,B., Lander,E., Galagan,J., Devon,K., Nusbaum,C., Ma,L.-J.,
Jaffe,D., Butler,J., Alvarez,P., Gnerre,S., Grabherr,M., Kleber,M.,
Mauceli,E., Brockman,W., Rounsley,S., Young,S., LaButti,K.,
Pushparaj,V., DeCaprio,D., Crawford,M., Koehrsen,M., Engels,R.,
Montgomery,P., Pearson,M., Howarth,C., Kodira,C., Yandava,C.,
Zeng,Q., Alvarado,L., Oleary,S. and Untereiner,W.

“Annotation of the Chaetomium globosum CBS 148.51 Genome”
Unpublished (2004) The Broad Institute Genome Sequencing Platform

Protein ref. UniProtKB:   Q2H890
DNA ref. JGI genome:   scaffold_2 (4591937..4589612)
Cluster/Prediction ref. GenBank:   XM_001230079
Protein sequence: CgKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   737
PWM (Da):   %s   81909.37  
PI (pH):   %s   6.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGLVPESVQKVAHAALGSREGDKLKDLAHNTKDMTDKDRLTTDYGVKQSTADDWLKAASKDKTGPLLLEDPFARERIMRFDHERIPERVVHARGAGAFGKFRVYDGIDELTSAPVLTDTSRETPVFVRFSTVLGSRGSMDTARDVRGFAVKFYTEEGNWDLVGNDIPVFFIQDAIKFPDVIHAGKPEPHNEVPQAQSAHNNFWDFQFNHTEATHMFLWTMSDRAIPRSWRMMQGFGVNTFTLINAKGERHFVKFTWTPELGVHSLVWDEALKLGGQDPDFHRKDLWEAIANGVFPKWKFGIQVIPEADEHKFDFDILDATKVWPEDLVPTRYIGEMELNRNPDEFFTQVEQIAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQISRLGVNFEELPINRPTCPVMNFNRDGALRHTITRGTVNYWPNRFQACPPASAAEGAYVEYAQKVAGIKARIRSAKFQDHFSQAQLFWNSMTPIEKHHIIAAFAFELDHCEDPVVYSRMVNRLADIDLTLAQTVAERVGGDVPTEPGRPNHGRRAPALSQIEFPGSSPTIASRRVAILVADGYDAVAYDAAYAALSAAMAVPLVIAQRRSKVVAADGKASVQPHHHLEGFRSTMVDAVFIPGGAKAVETLGKNGRALHWVREAFGHLKTIGATGEAVELVERAIGLPSVTVSTSGEVQESYGVVTIKELRPESLGEAVTIAKGARGFMEKFFYGISQHRCWERELAGLNAQVAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="CBS 148.51".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGCCTCGTCCCCGAATCCGTGCAAAAGGTGGCGCACGCCGCGCTCGGCTCCCGCGAAGGAGACAAGCTCAAAGACCTCGCTCACAACACCAAGGATATGACGGATAAGGACCGA
CTGACAACAGACTATGGCGTCAAGCAAAGTACCGCTGATGACTGGCTCAAGGCGGCTAGCAAAGATAAGACAGGGCCACTCCTATTGGAGGACCCCTTTGCACGCGAGAGG
GTGAGTTGC
TTCCGTTATCATTTGAGGGAACGGTACTAATGACTATCTCAGATCATGAGATTTGACCATGAAAGGATTCCCGAGCGAGTGGTTCACGCCCGGGGCGCTGGTGCCTTTGGCAAGTTCAGG
GTGTATGATGGCATCGATGAGCTCACCTCCGCGCCGGTCCTGACCGACACATCGCGCGAAACCCCTGTTTTCGTCCGCTTCTCTACTGTCCTAGGAAGCCGGGGCAGCATGGACACCGCG
CGCGACGTGCGTGGTTTCGCCGTCAAGTTCTACACCGAAGAGGGGAACTGGGACCTCGTCGGCAACGACATACCCGTCTTCTTCATCCAGGATGCCATCAAATTTCCAGACGTTATTCAC
GCCGGCAAGCCCGAGCCACACAACGAGGTGCCCCAGGCCCAGTCGGCTCACAACAACTTCTGGGACTTCCAGTTTAACCACACCGAAGCGACACACATGTTTCTGTGGACG
GTAAGCCTT
TGCTCCATCCACCTACCGTCCCTGACGATGCCTCAGATGCTAACCTCACCAGATGAGCGACCGGGCTATCCCTCGTTCCTGGCGCATGATGCAGGGCTTTGGTGTCAACACGTTTACTTT
GATCAATGCAAAGGGCGAGCGGCACTTTGTCAAGTTCACATGGACCCCCGAACTCGGCGTGCACTCGTTAGTGTGGGACGAGGCACTCAAGCTCGGCGGCCAGGACCCCGACTTCCACCG
CAAGGACCTCTGGGAAGCCATCGCGAACGGCGTGTTCCCCAAATGGAAGTTTGGCATCCAAGTCATCCCCGAAGCCGACGAGCACAAGTTCGACTTTGACATCCTCGACGCCACCAAGGT
CTGGCCCGAGGACCTCGTCCCGACCCGCTACATCGGCGAGATGGAGCTCAACCGCAACCCCGACGAGTTCTTCACCCAGGTCGAGCAGATCGCCTTCTGCACCAGCCACGTCGTCCCCGG
CATCGGCTTCAGCGACGACCCGCTCCTCCAGGGCCGCAACTTCAGCTACTTCGATACGCAAATCTCCCGCCTCGGCGTCAACTTCGAAGAACTCCCCATCAACCGCCCAACCTGCCCCGT
CATGAACTTCAACCGCGACGGCGCCCTCCGCCACACCATCACTCGCGGCACCGTCAACTACTGGCCCAACCGCTTCCAAGCCTGCCCGCCCGCCAGCGCCGCCGAAGGCGCCTACGTGGA
GTACGCCCAAAAGGTCGCCGGCATCAAAGCCCGCATCCGCAGCGCCAAGTTCCAAGACCACTTCAGCCAGGCCCAGCTCTTCTGGAACAGCATGACCCCCATCGAAAAACATCACATCAT
CGCCGCCTTCGCCTTCGAGCTCGACCACTGCGAGGACCCCGTCGTCTACTCCCGCATGGTCAACCGCCTCGCCGACATCGACCTCACCCTCGCCCAGACCGTCGCCGAGCGCGTCGGCGG
CGACGTCCCCACGGAGCCGGGCCGGCCTAATCATGGTCGTCGCGCACCCGCCCTCAGCCAGATTGAGTTTCCGGGGTCGTCGCCGACGATTGCCTCACGCCGTGTTGCGATCCTGGTGGC
GGATGGGTATGATGCGGTCGCGTATGATGCGGCGTATGCCGCGCTGTCGGCGGCCATGGCCGTGCCGTTGGTGATTGCCCAGCGGCGGAGTAAGGTGGTGGCGGCGGATGGGAAGGCGTC
GGTGCAGCCGCATCATCATCTGGAGGGGTTTCGGTCGACCATGGTTGACGCGGTGTTTATCCCGGGCGGTGCGAAGGCGGTGGAGACGCTGGGAAAGAATGGGCGCGCGCTGCATTGGGT
GAGGGAGGCGTTTGGGCATTTGAAGACGATTGGGGCGACGGGGGAGGCGGTGGAGTTGGTGGAGAGGGCGATTGGCCTGCCGAGTGTTACCGTGTCGACGTCGGGAGAGGTGCAGGAGAG
TTATGGAGTGGTGACGATCAAGGAGTTGAGGCCGGAGAGCTTGGGTGAGGCGGTCACCATTGCGAAGGGGGCGAGGGGGTTCATGGAGAAGTTCTTTTATGGCATCTCGCAGCATCGTTG
TTGGGAGAGGGAGCTGGCCGGGTTGAATGCCCAGGTTGCATATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGGCCTCGTCCCCGAATCCGTGCAAAAGGTGGCGCACGCCGCGCTCGGCTCCCGCGAAGGAGACAAGCTCAAAGACCTCGCTCACAACACCAAGGATATGACGGATAAGGACCGA
CTGACAACAGACTATGGCGTCAAGCAAAGTACCGCTGATGACTGGCTCAAGGCGGCTAGCAAAGATAAGACAGGGCCACTCCTATTGGAGGACCCCTTTGCACGCGAGAGG
ATCATGAGA
TTTGACCATGAAAGGATTCCCGAGCGAGTGGTTCACGCCCGGGGCGCTGGTGCCTTTGGCAAGTTCAGGGTGTATGATGGCATCGATGAGCTCACCTCCGCGCCGGTCCTGACCGACACA
TCGCGCGAAACCCCTGTTTTCGTCCGCTTCTCTACTGTCCTAGGAAGCCGGGGCAGCATGGACACCGCGCGCGACGTGCGTGGTTTCGCCGTCAAGTTCTACACCGAAGAGGGGAACTGG
GACCTCGTCGGCAACGACATACCCGTCTTCTTCATCCAGGATGCCATCAAATTTCCAGACGTTATTCACGCCGGCAAGCCCGAGCCACACAACGAGGTGCCCCAGGCCCAGTCGGCTCAC
AACAACTTCTGGGACTTCCAGTTTAACCACACCGAAGCGACACACATGTTTCTGTGGACG
ATGAGCGACCGGGCTATCCCTCGTTCCTGGCGCATGATGCAGGGCTTTGGTGTCAACACG
TTTACTTTGATCAATGCAAAGGGCGAGCGGCACTTTGTCAAGTTCACATGGACCCCCGAACTCGGCGTGCACTCGTTAGTGTGGGACGAGGCACTCAAGCTCGGCGGCCAGGACCCCGAC
TTCCACCGCAAGGACCTCTGGGAAGCCATCGCGAACGGCGTGTTCCCCAAATGGAAGTTTGGCATCCAAGTCATCCCCGAAGCCGACGAGCACAAGTTCGACTTTGACATCCTCGACGCC
ACCAAGGTCTGGCCCGAGGACCTCGTCCCGACCCGCTACATCGGCGAGATGGAGCTCAACCGCAACCCCGACGAGTTCTTCACCCAGGTCGAGCAGATCGCCTTCTGCACCAGCCACGTC
GTCCCCGGCATCGGCTTCAGCGACGACCCGCTCCTCCAGGGCCGCAACTTCAGCTACTTCGATACGCAAATCTCCCGCCTCGGCGTCAACTTCGAAGAACTCCCCATCAACCGCCCAACC
TGCCCCGTCATGAACTTCAACCGCGACGGCGCCCTCCGCCACACCATCACTCGCGGCACCGTCAACTACTGGCCCAACCGCTTCCAAGCCTGCCCGCCCGCCAGCGCCGCCGAAGGCGCC
TACGTGGAGTACGCCCAAAAGGTCGCCGGCATCAAAGCCCGCATCCGCAGCGCCAAGTTCCAAGACCACTTCAGCCAGGCCCAGCTCTTCTGGAACAGCATGACCCCCATCGAAAAACAT
CACATCATCGCCGCCTTCGCCTTCGAGCTCGACCACTGCGAGGACCCCGTCGTCTACTCCCGCATGGTCAACCGCCTCGCCGACATCGACCTCACCCTCGCCCAGACCGTCGCCGAGCGC
GTCGGCGGCGACGTCCCCACGGAGCCGGGCCGGCCTAATCATGGTCGTCGCGCACCCGCCCTCAGCCAGATTGAGTTTCCGGGGTCGTCGCCGACGATTGCCTCACGCCGTGTTGCGATC
CTGGTGGCGGATGGGTATGATGCGGTCGCGTATGATGCGGCGTATGCCGCGCTGTCGGCGGCCATGGCCGTGCCGTTGGTGATTGCCCAGCGGCGGAGTAAGGTGGTGGCGGCGGATGGG
AAGGCGTCGGTGCAGCCGCATCATCATCTGGAGGGGTTTCGGTCGACCATGGTTGACGCGGTGTTTATCCCGGGCGGTGCGAAGGCGGTGGAGACGCTGGGAAAGAATGGGCGCGCGCTG
CATTGGGTGAGGGAGGCGTTTGGGCATTTGAAGACGATTGGGGCGACGGGGGAGGCGGTGGAGTTGGTGGAGAGGGCGATTGGCCTGCCGAGTGTTACCGTGTCGACGTCGGGAGAGGTG
CAGGAGAGTTATGGAGTGGTGACGATCAAGGAGTTGAGGCCGGAGAGCTTGGGTGAGGCGGTCACCATTGCGAAGGGGGCGAGGGGGTTCATGGAGAAGTTCTTTTATGGCATCTCGCAG
CATCGTTGTTGGGAGAGGGAGCTGGCCGGGTTGAATGCCCAGGTTGCATATTAG

Retrieve as FASTA