Entry information : GzKat02-1B (GzKat02b)
Entry ID 5201
Creation 2007-04-13 (Marcel Zamocky)
Last sequence changes 2007-04-13 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzKat02-1B (GzKat02b)
Name (synonym) GzKat02-1B (GzKat02b)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzKat02-1B
start..stop
S start..stop
GmoKat01 790 0 10..475 5..470
NcKat04 556 0 11..475 7..469
CnKat04_grubiiH99 520 0 9..471 4..473
CnKat04_JEC21 516 0 9..471 4..473
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5131387..5131395 9 N° 2 5131257..5131299 43 N° 3 5131066..5131198 133 N° 4 5130511..5130970 460
N° 5 5130165..5130452 288 N° 6 5129415..5130080 666  
complement(join(5129415..5130080,5130165..5130452,5130511..5130970,5131066..5131 198,5131257..5131299,5131387..5131395))


exon

Literature and cross-references GzKat02-1B (GzKat02b)
Literature unpublished, the Broad Institute sequencing platform
Protein ref. UniProtKB_Uniparc:   Q4IIS7
DNA ref. JGI genome:   Supercontig_3.2 (5131395..5129415)
Protein sequence: GzKat02-1B (GzKat02b)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   532
PWM (Da):   %s   60159.13  
PI (pH):   %s   7.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSSAKLGENPISTLANGQPTENPGSTQQIRYGQSNGGLVVLSDTQTIEILAHFARERIPERSVHAKAAGATGEFEVLEDLSDITDANFLSEKGKKTPMLMRISTVGGEKGSADTVRDVRGWSTKLYTEEGIQDFVFNDLPVFFIREPIKFPSMNRSHKRHPRTNVPDNAMFWDYHVNNPEGIHALMHLFGQRGIPASLRHISGFGVHTYTLNKDGSYVYVKWHYKPEGGIETMDSETAARLAGTDPDYHVKDLFNAIEKGDYPSWIVYIQVMRPEEVMAAPIDIFDCTYTWPHEKYPLRRVGQMTLKKNPDNYFQDIEQACFSPSNMVPGIGPSADPVLQARMFSYPDAHRYRVGPNYFQLPPNRPRNQVYAPCVRDGPGTMNGNYGGDPDYVFSQLRPVSVSKRVQVPTHEHFDGKVTSVVTEFTDKDYVQARELWKIICGEDKGKRQFFNNIAPTIKDLPVKLQGKVLGRFILEYMAVTPTNKAERVVGLVLTGYRLPFWSGSRNQDNSYSSYELVLNWKYIYRWLLL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 2, 6 exons). Strain="PH-1/NRRL 31084". Variation of catalase 2, difference on C-terminus in Swiss Prot and in Broad Institute database - update FGSG_02881.3 "EVIDENCE_CHANGED"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCAGTGAGAACTCCATTCCAACTATAATAATGTGGTTTTCTCTGCTTTTCAACAATGCTCTCATGTTACCTGTAGCTAACTTTCATCTAGTCTGCCAAACTCGGGGAGAACCCG
ATAAGCACTCTTGCCAATG
GTATGATATATCATTCACCATATATTCTTGTTCAAGGGCTAACGTTGAAGATCCACAGGACAACCAACGGAGAATCCTGGTAGTACACAGCAGATTCGATA
TGGCCAAAGTAACGGTGGTCTAGTCGTGCTCAGTGACACCCAGACGATTGAGATACTAGCTCACTTTGCACGCGAACGGATTCCGGAGAG
GTATGTAGTCGTAGTGTCACGTTGTTTTTC
TTTTTCACATTCCTTTTGATATTATTAACACCGTTGTCGTTGCTGACTCTCCATTCATCTCTCAGGAGCGTGCATGCCAAGGCCGCCGGTGCAACTGGTGAATTCGAGGTCCTCGAGGAC
CTTTCTGACATCACTGACGCCAATTTCTTGTCAGAAAAGGGGAAGAAGACACCTATGCTCATGCGCATCTCGACTGTTGGCGGCGAAAAAGGCTCGGCAGACACAGTTCGCGATGTCAGA
GGCTGGTCAACGAAGCTGTATACTGAAGAGGGCATCCAGGATTTCGTATTTAACGACTTGCCAGTATTCTTCATCCGCGAGCCCATAAAGTTCCCGTCGATGAACAGGAGTCACAAACGG
CATCCAAGAACTAATGTCCCTGATAATGCCATGTTCTGGGACTATCACGTTAATAACCCGGAAGGCATCCATGCCCTCATGCACTTGTTTGGGCAGCGAGGTATACCTGCTTCACTGCGG
CACATCAGTGGCTTTGGAGTTCATACATACACGCTGAATAAAGCG
GTGAGTGGAGGCCACCTCTTCTGCTCTTCGTAAAGTATTACTAAGACACAAATAACAGGATGGGAGCTACGTCTA
CGTCAAGTGGCATTACAAGCCAGAAGGCGGCATCGAGACGATGGATTCGGAGACAGCAGCACGACTTGCAGGCACTGACCCTGATTACCACGTAAAAGACCTCTTCAACGCTATTGAGAA
AGGCGACTATCCATCGTGGATTGTTTATATCCAAGTCATGCGTCCGGAGGAAGTTATGGCCGCACCCATCGACATATTTGACTGTACATACACCTGGCCCCATGAGAAGTACCCTCTGAG
ACGAGTGGGACAAATGACGTTGAAAAAGAAT
GTAAGCAAATTGAATAACCCCGAAAACGAGGAATATTGCATCACCTGCGGTTGTTTATGCTGACATCCCATGTGCCCAACGCAGCCCGA
TAATTATTTTCAAGACATTGAACAAGCCTGCTTCTCTCCCTCCAACATGGTCCCTGGCATCGGCCCTTCAGCGGACCCAGTCCTCCAAGCACGCATGTTCAGTTACCCCGACGCCCACCG
CTACCGGGTTGGGCCCAACTATTTTCAACTCCCCCCCAATCGACCCCGCAACCAAGTCTACGCACCCTGCGTTCGTGATGGCCCCGGCACAATGAACGGAAACTACGGCGGTGATCCGGA
TTACGTCTTCTCGCAGCTAAGACCCGTTAGTGTAAGTAAGCGGGTGCAAGTCCCCACACATGAGCACTTTGACGGAAAGGTCACATCTGTGGTTACAGAGTTCACAGATAAGGACTACGT
ACAGGCTAGGGAGCTGTGGAAGATCATTTGCGGGGAGGACAAGGGGAAACGACAGTTTTTTAACAACATTGCGCCGACTATCAAGGATCTGCCGGTGAAGTTACAGGGTAAGGTGTTAGG
TAGGTTTATCCTGGAATACATGGCTGTGACACCTACCAATAAGGCAGAGAGAGTTGTTGGATTAGTGCTGACAGGTTACAGATTACCTTTCTGGAGTGGATCCCGAAATCAAGACAATTC
TTACAGCTCATATGAATTAGTTTTGAATTGGAAGTACATATACCGGTGGTTGTTATTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCATCTGCCAAACTCGGGGAGAACCCGATAAGCACTCTTGCCAATGGACAACCAACGGAGAATCCTGGTAGTACACAGCAGATTCGATATGGCCAAAGTAACGGTGGTCTAGTC
GTGCTCAGTGACACCCAGACGATTGAGATACTAGCTCACTTTGCACGCGAACGGATTCCGGAGAG
GAGCGTGCATGCCAAGGCCGCCGGTGCAACTGGTGAATTCGAGGTCCTCGAGGAC
CTTTCTGACATCACTGACGCCAATTTCTTGTCAGAAAAGGGGAAGAAGACACCTATGCTCATGCGCATCTCGACTGTTGGCGGCGAAAAAGGCTCGGCAGACACAGTTCGCGATGTCAGA
GGCTGGTCAACGAAGCTGTATACTGAAGAGGGCATCCAGGATTTCGTATTTAACGACTTGCCAGTATTCTTCATCCGCGAGCCCATAAAGTTCCCGTCGATGAACAGGAGTCACAAACGG
CATCCAAGAACTAATGTCCCTGATAATGCCATGTTCTGGGACTATCACGTTAATAACCCGGAAGGCATCCATGCCCTCATGCACTTGTTTGGGCAGCGAGGTATACCTGCTTCACTGCGG
CACATCAGTGGCTTTGGAGTTCATACATACACGCTGAATAAAGCG
GATGGGAGCTACGTCTACGTCAAGTGGCATTACAAGCCAGAAGGCGGCATCGAGACGATGGATTCGGAGACAGCA
GCACGACTTGCAGGCACTGACCCTGATTACCACGTAAAAGACCTCTTCAACGCTATTGAGAAAGGCGACTATCCATCGTGGATTGTTTATATCCAAGTCATGCGTCCGGAGGAAGTTATG
GCCGCACCCATCGACATATTTGACTGTACATACACCTGGCCCCATGAGAAGTACCCTCTGAGACGAGTGGGACAAATGACGTTGAAAAAGAAT
CCCGATAATTATTTTCAAGACATTGAA
CAAGCCTGCTTCTCTCCCTCCAACATGGTCCCTGGCATCGGCCCTTCAGCGGACCCAGTCCTCCAAGCACGCATGTTCAGTTACCCCGACGCCCACCGCTACCGGGTTGGGCCCAACTAT
TTTCAACTCCCCCCCAATCGACCCCGCAACCAAGTCTACGCACCCTGCGTTCGTGATGGCCCCGGCACAATGAACGGAAACTACGGCGGTGATCCGGATTACGTCTTCTCGCAGCTAAGA
CCCGTTAGTGTAAGTAAGCGGGTGCAAGTCCCCACACATGAGCACTTTGACGGAAAGGTCACATCTGTGGTTACAGAGTTCACAGATAAGGACTACGTACAGGCTAGGGAGCTGTGGAAG
ATCATTTGCGGGGAGGACAAGGGGAAACGACAGTTTTTTAACAACATTGCGCCGACTATCAAGGATCTGCCGGTGAAGTTACAGGGTAAGGTGTTAGGTAGGTTTATCCTGGAATACATG
GCTGTGACACCTACCAATAAGGCAGAGAGAGTTGTTGGATTAGTGCTGACAGGTTACAGATTACCTTTCTGGAGTGGATCCCGAAATCAAGACAATTCTTACAGCTCATATGAATTAGTT
TTGAATTGGAAGTACATATACCGGTGGTTGTTATTGTAG

Retrieve as FASTA