Entry information : CheKat02_C4 (CAT2)
Entry ID 5202
Creation 2007-04-13 (Marcel Zamocky)
Last sequence changes 2007-04-13 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: CheKat02_C4 (CAT2)
Name (synonym) CheKat02_C4 (CAT2)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value CheKat02_C4
start..stop
S start..stop
CheKat02_C5 1551 0 1..740 1..740
PtritKat01 1453 0 1..740 1..740
PnoKat02 1344 0 1..740 1..743
CfulKat02 1122 0 3..740 7..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 406069..406299 231 N° 2 404023..406014 1992  
complement(join(404023..406014,406069..406299))


exon

Literature and cross-references CheKat02_C4 (CAT2)
Literature Robbertse B., Yoder O.C., Nguyen A., Schoch C.L., Turgeon B.G. Deletion of all Cochliobolus heterostrophus monofunctional catalase-encoding genes reveals a role for one in sensitivity to oxidative stress but none with a role in virulence. Mol. Plant Microbe Interact. 16:1013-1021(2003).
Protein ref. UniProtKB:   Q6UJ33
DNA ref. JGI genome:   scaffold_15 (406299..404023)
Protein sequence: CheKat02_C4 (CAT2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   83017.01  
PI (pH):   %s   6.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASEILGNVTEKAKDLAGSKSTKMAQLAEVTKDVHDDKWRITSDYGVKQNNTDDWLKVATDDQTGPMLLEDQFAREKIHRFDHERIPERVVHARGSGAFGKFTLFESASDVTSAGILTDTSRETPVFLRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDIVGNNIPVFFIQDSMKFPDVIHAGKPEPDCEVPQAQSAHNNFWDFQYMHPEATHMFMWAMSDRTIPRSYRMMQGFGVNTYTLINAKGERHFVKFHFTPELGVHSFVWDEALKIAGQDPDFHRKDLWMAIDSGAYPKWKFGIQVIPEAKEHDFEFDILDATKVWPEELVPVRYIGELELNKNPDEFFTQTEQVAFCTSHIVPGIGFSNDPLLQGRNFSYQDTQLSRLGINWEELPINKPVCPVMNFNRDGAMRHTITKGKVNYWPNRFQTVPPATEKEGGYVEFPEKTAGIKVRMQSKKFREHKSQAELFYNSMSENEKMHMKAAFAFELDHCDDPVVYERLCERLCEIDLELAQSVAEMVGGEQPTKQTRPKHNKTAKGLSQMDFQPEKPTIATRMVAILIADGYDKAAYTGMKAALTAAGALPFTISPRRNKIFADGEDRSGSGVVADHHLEGQRSTMYDSVFVPGGARSIETLSKNGRAVHWVREAFGHLKAIGGTGEAVSFIKQAVDLPGMEFSTSGDVVNSYGVVTATAVQPESFKEAVNMVKEAKDFASAYMYAISQHKNFERETAGLNAMVAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Strain="C4/ATCC 48331".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCTGAAATACTAGGCAACGTTACGGAGAAGGCCAAGGACCTTGCTGGGTCCAAGTCGACCAAGATGGCTCAGCTTGCTGAAGTCACCAAAGATGTCCACGACGACAAGTGGAGG
ATTACCAGCGACTATGGAGTGAAGCAGAACAACACCGACGACTGGCTAAAGGTTGCCACGGACGACCAGACTGGCCCTATGTTGCTCGAGGACCAATTTGCGCGTGAAAAG
GTATGCTTG
GCCATGAACCAGCCGACGTATTCGCCACATGGCTAACAGCATTAGATCCACCGATTCGACCATGAAAGAATTCCCGAGCGTGTTGTTCACGCGCGTGGCTCGGGTGCTTTTGGAAAATTT
ACTCTTTTCGAGTCGGCCTCGGATGTCACATCGGCTGGCATCCTCACGGATACTTCGCGCGAAACTCCAGTCTTCCTACGATTCTCGACTGTGCTTGGTAGCCGTGGTTCTGCAGACACT
GTCCGCGATGTGCGCGGCTTTGCTGTCAAGTTCTACACGGAAGAAGGCAACTGGGATATTGTGGGTAACAACATTCCCGTCTTTTTCATCCAAGACTCGATGAAGTTTCCCGATGTGATC
CATGCTGGCAAGCCGGAGCCGGACTGCGAGGTCCCACAAGCACAATCTGCTCACAACAACTTCTGGGACTTCCAGTACATGCACCCCGAAGCCACGCACATGTTCATGTGGGCCATGTCT
GACCGCACGATTCCTCGCTCGTACCGAATGATGCAGGGTTTCGGTGTCAACACATACACTCTTATCAATGCCAAGGGCGAGAGGCATTTTGTCAAGTTCCACTTCACACCTGAACTTGGT
GTTCACAGCTTCGTCTGGGATGAGGCGCTGAAGATTGCTGGTCAAGACCCAGACTTCCACCGCAAGGACTTGTGGATGGCCATCGACAGCGGTGCGTACCCCAAGTGGAAGTTTGGCATT
CAAGTCATTCCCGAGGCAAAGGAGCATGACTTCGAATTCGACATTCTCGATGCTACCAAAGTATGGCCTGAGGAACTTGTGCCCGTCCGATACATTGGCGAGCTTGAGCTCAACAAGAAC
CCTGACGAGTTCTTTACACAGACTGAGCAAGTCGCCTTCTGCACAAGCCACATTGTTCCCGGCATAGGCTTCAGCAACGACCCCCTTCTACAGGGCCGCAACTTCTCTTATCAAGACACT
CAACTCTCTCGTCTGGGCATCAACTGGGAAGAGCTACCAATCAACAAGCCCGTCTGCCCCGTCATGAACTTCAACCGTGATGGTGCCATGCGACACACAATCACAAAGGGCAAGGTCAAC
TACTGGCCCAACCGCTTCCAGACTGTGCCACCTGCGACAGAGAAGGAGGGTGGATACGTGGAGTTCCCTGAGAAGACTGCCGGCATCAAGGTGCGCATGCAAAGCAAAAAGTTCAGGGAG
CACAAGAGCCAGGCCGAGCTCTTCTACAACTCCATGTCGGAGAACGAAAAGATGCACATGAAGGCTGCTTTTGCCTTTGAGCTTGACCACTGCGACGATCCGGTTGTGTACGAGCGCCTC
TGTGAGCGTCTGTGCGAGATTGATCTCGAGCTCGCTCAGAGTGTTGCCGAGATGGTTGGCGGCGAGCAACCGACCAAGCAGACCCGGCCCAAGCACAACAAGACAGCCAAGGGCCTGTCG
CAAATGGACTTTCAGCCCGAGAAGCCTACGATTGCGACTCGCATGGTGGCAATTCTTATTGCCGACGGCTACGACAAGGCTGCCTACACTGGCATGAAGGCTGCTTTGACTGCGGCTGGG
GCTCTGCCTTTTACCATTTCGCCGAGAAGGAACAAGATCTTTGCGGATGGAGAGGACAGGAGCGGCTCTGGAGTAGTGGCAGACCACCATCTTGAGGGCCAACGATCGACCATGTATGAC
AGTGTCTTCGTTCCTGGTGGGGCCAGGTCGATTGAGACGCTCAGCAAGAACGGACGTGCGGTACACTGGGTGCGTGAGGCATTTGGCCACCTCAAGGCCATTGGTGGTACCGGCGAAGCA
GTTTCCTTCATCAAGCAGGCTGTGGATCTACCCGGCATGGAATTCTCAACGTCGGGCGATGTGGTCAACAGCTACGGAGTCGTTACGGCTACGGCAGTGCAGCCCGAGAGCTTCAAGGAG
GCGGTCAACATGGTGAAGGAGGCCAAGGACTTTGCGAGCGCGTACATGTATGCGATTTCGCAGCACAAGAACTTTGAGCGCGAGACTGCGGGGCTGAACGCCATGGTTGCATACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCTGAAATACTAGGCAACGTTACGGAGAAGGCCAAGGACCTTGCTGGGTCCAAGTCGACCAAGATGGCTCAGCTTGCTGAAGTCACCAAAGATGTCCACGACGACAAGTGGAGG
ATTACCAGCGACTATGGAGTGAAGCAGAACAACACCGACGACTGGCTAAAGGTTGCCACGGACGACCAGACTGGCCCTATGTTGCTCGAGGACCAATTTGCGCGTGAAAAG
ATCCACCGA
TTCGACCATGAAAGAATTCCCGAGCGTGTTGTTCACGCGCGTGGCTCGGGTGCTTTTGGAAAATTTACTCTTTTCGAGTCGGCCTCGGATGTCACATCGGCTGGCATCCTCACGGATACT
TCGCGCGAAACTCCAGTCTTCCTACGATTCTCGACTGTGCTTGGTAGCCGTGGTTCTGCAGACACTGTCCGCGATGTGCGCGGCTTTGCTGTCAAGTTCTACACGGAAGAAGGCAACTGG
GATATTGTGGGTAACAACATTCCCGTCTTTTTCATCCAAGACTCGATGAAGTTTCCCGATGTGATCCATGCTGGCAAGCCGGAGCCGGACTGCGAGGTCCCACAAGCACAATCTGCTCAC
AACAACTTCTGGGACTTCCAGTACATGCACCCCGAAGCCACGCACATGTTCATGTGGGCCATGTCTGACCGCACGATTCCTCGCTCGTACCGAATGATGCAGGGTTTCGGTGTCAACACA
TACACTCTTATCAATGCCAAGGGCGAGAGGCATTTTGTCAAGTTCCACTTCACACCTGAACTTGGTGTTCACAGCTTCGTCTGGGATGAGGCGCTGAAGATTGCTGGTCAAGACCCAGAC
TTCCACCGCAAGGACTTGTGGATGGCCATCGACAGCGGTGCGTACCCCAAGTGGAAGTTTGGCATTCAAGTCATTCCCGAGGCAAAGGAGCATGACTTCGAATTCGACATTCTCGATGCT
ACCAAAGTATGGCCTGAGGAACTTGTGCCCGTCCGATACATTGGCGAGCTTGAGCTCAACAAGAACCCTGACGAGTTCTTTACACAGACTGAGCAAGTCGCCTTCTGCACAAGCCACATT
GTTCCCGGCATAGGCTTCAGCAACGACCCCCTTCTACAGGGCCGCAACTTCTCTTATCAAGACACTCAACTCTCTCGTCTGGGCATCAACTGGGAAGAGCTACCAATCAACAAGCCCGTC
TGCCCCGTCATGAACTTCAACCGTGATGGTGCCATGCGACACACAATCACAAAGGGCAAGGTCAACTACTGGCCCAACCGCTTCCAGACTGTGCCACCTGCGACAGAGAAGGAGGGTGGA
TACGTGGAGTTCCCTGAGAAGACTGCCGGCATCAAGGTGCGCATGCAAAGCAAAAAGTTCAGGGAGCACAAGAGCCAGGCCGAGCTCTTCTACAACTCCATGTCGGAGAACGAAAAGATG
CACATGAAGGCTGCTTTTGCCTTTGAGCTTGACCACTGCGACGATCCGGTTGTGTACGAGCGCCTCTGTGAGCGTCTGTGCGAGATTGATCTCGAGCTCGCTCAGAGTGTTGCCGAGATG
GTTGGCGGCGAGCAACCGACCAAGCAGACCCGGCCCAAGCACAACAAGACAGCCAAGGGCCTGTCGCAAATGGACTTTCAGCCCGAGAAGCCTACGATTGCGACTCGCATGGTGGCAATT
CTTATTGCCGACGGCTACGACAAGGCTGCCTACACTGGCATGAAGGCTGCTTTGACTGCGGCTGGGGCTCTGCCTTTTACCATTTCGCCGAGAAGGAACAAGATCTTTGCGGATGGAGAG
GACAGGAGCGGCTCTGGAGTAGTGGCAGACCACCATCTTGAGGGCCAACGATCGACCATGTATGACAGTGTCTTCGTTCCTGGTGGGGCCAGGTCGATTGAGACGCTCAGCAAGAACGGA
CGTGCGGTACACTGGGTGCGTGAGGCATTTGGCCACCTCAAGGCCATTGGTGGTACCGGCGAAGCAGTTTCCTTCATCAAGCAGGCTGTGGATCTACCCGGCATGGAATTCTCAACGTCG
GGCGATGTGGTCAACAGCTACGGAGTCGTTACGGCTACGGCAGTGCAGCCCGAGAGCTTCAAGGAGGCGGTCAACATGGTGAAGGAGGCCAAGGACTTTGCGAGCGCGTACATGTATGCG
ATTTCGCAGCACAAGAACTTTGAGCGCGAGACTGCGGGGCTGAACGCCATGGTTGCATACTAA

Retrieve as FASTA