Entry information : AorKat01
Entry ID 5203
Creation 2007-04-13 (Marcel Zamocky)
Last sequence changes 2016-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-27 (Achraf Jemmat)
Peroxidase information: AorKat01
Name AorKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus oryzae    [TaxId: 5062 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AorKat01
start..stop
S start..stop
AorKat02 1533 0 1..747 1..747
NfKat01 1294 0 1..747 1..746
AnKat01 1291 0 1..747 1..748
AclKat01 1285 0 1..747 1..746
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..237 237 N° 2 296..608 313 N° 3 662..2355 1694  
join(1..237,296..608,662..2355)


exon

Literature and cross-references AorKat01
Literature Machida M. et al.,Genome sequencing and analysis of Aspergillus oryzae. Nature 438:1157-1161(2005).
Protein ref. GenBank:   BAE61903.1 UniProtKB:   Q2U962
DNA ref. GenBank:   AP007164.1 (447410..445056)
mRNA ref. GenBank:   XM_001822984.2 (87..2327)
Protein sequence: AorKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   747
PWM (Da):   %s   83660.42  
PI (pH):   %s   6.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANIVAGGLHKVQEAVQGAASKDKKLVDLAPDTHNVQSSKEPLTTDHGVRISDTDHWLKEVNDNHTGPMMLEDQIAREKIHRFDHERIPERVVHARGTAAFGNFKLHESAEDVSYAGILTDTSRNTPVFLRFSTVQGSKGSADTVRDVRGFAVKFYTDEGNWDLVGNNIPVFFIQDAIKFPDFVHAVKPEPHNEVPQAQTAHNNFWDFVYLHPEATHMFMWAMSDRAIPRSYRMMQGFGVNTFSLINKEGKRHFVKFHFIPHLGVHSLVWDEALKLAGQDPDFHRKDLMEAIDNGAYPKWDFAIQVIPEEKQDDFEFDIFDATKIWPEELVPLRVIGELELNRNVDEFFPQTEQVAFCTSHIVPGIDFSDDPLLQGRNFSYFDTQISRLGINWEEIPINRPVCPVLNHNRDGAKRHRIAQGTVNYWPNRFEAGPPAPVEQGGFASYPAKLNGIKKRGLSPKFREHHNQAQLFYNSLSEHEKVHVKKAFGFELDHCDDPIVYERLAGHRLAEIDLTLAQEVAELVGAPIPDKALRPNHGKRSKHLSQTEFPGKQPTIASRRIAIIIGDGYDPVAFNGLKGAITAVGALPFVIGTKRSPIYADGEDKSSSKGVIADHQYDGQRSTMFDATFIPGGPHVESLKANGQIRYWIIETFGHLKALGATGEAAAFIKEALGSALDVKVATSDNPQPVEWYGVVTAGKIHKPESFKEGIQIVKDAKDFISTFFYQISQHRNYKRELDGLASTVAF

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="ATCC 42149 / RIB 40".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATATTGTGGCTGGGGGCCTCCACAAGGTTCAAGAAGCAGTGCAGGGCGCTGCTTCCAAGGATAAGAAGCTAGTTGACCTAGCACCCGACACCCATAATGTACAGTCCAGCAAG
GAGCCACTGACCACCGACCATGGTGTGCGTATCAGCGATACGGACCACTGGCTGAAGGAGGTGAATGACAATCACACCGGTCCTATGATGCTTGAGGACCAGATTGCACGAGAGAAG
GTA
TGATTCCCCGAATCGGTATGGGTCAGAACCATAGATTGAACGAATCGCAACCCAGATTCATCGTTTCGATCATGAGCGCATTCCCGAGAGAGTCGTCCATGCGCGTGGCACCGCTGCATT
CGGAAACTTCAAGCTCCATGAGAGCGCTGAAGATGTATCCTACGCTGGTATCTTGACGGATACCTCAAGGAACACTCCGGTTTTCCTTCGTTTCTCCACGGTCCAGGGCAGTAAAGGAAG
TGCCGACACCGTCCGTGACGTTCGTGGGTTTGCCGTGAAATTCTACACCGACGAAGGAAATTGGGATCTGGTTGGAAACAACATCCCCGTTTTCTTTATCCAAGATGCGATTAAGTTCCC
GGATTTTG
GTACGTACCTCCTCCCAACTATGAGTCCAAAACTCTAGAGCTAACGAGTGTAGTCCATGCTGTTAAGCCCGAGCCGCACAACGAGGTACCACAGGCCCAAACTGCTCACAAC
AACTTCTGGGACTTTGTCTATCTTCACCCGGAAGCCACCCATATGTTCATGTGGGCCATGTCTGATCGGGCCATTCCTCGGTCATACCGTATGATGCAGGGTTTCGGTGTCAACACATTC
AGTCTCATCAACAAGGAAGGAAAGCGCCATTTTGTCAAGTTCCATTTCATCCCCCACCTGGGAGTGCACTCTTTGGTGTGGGACGAGGCTCTGAAACTGGCTGGCCAGGACCCCGATTTC
CATCGCAAGGATCTCATGGAGGCCATTGATAACGGCGCATACCCGAAATGGGACTTCGCCATCCAGGTCATCCCTGAGGAGAAACAGGATGACTTCGAATTTGACATTTTCGACGCGACG
AAGATCTGGCCCGAGGAGCTCGTGCCTCTGCGCGTGATCGGCGAACTGGAACTGAACCGCAACGTCGACGAGTTCTTCCCTCAAACCGAGCAAGTCGCCTTCTGCACCAGCCACATCGTC
CCCGGCATTGACTTCAGTGACGACCCGCTTCTCCAGGGCCGTAACTTCTCCTACTTCGACACTCAGATCAGTCGACTGGGCATCAACTGGGAAGAAATCCCCATCAACCGCCCCGTCTGC
CCCGTTCTGAACCACAACCGAGACGGCGCCAAACGCCACCGCATCGCCCAGGGCACTGTCAACTACTGGCCGAACCGGTTTGAGGCCGGACCACCCGCACCAGTAGAACAAGGTGGCTTC
GCGTCCTACCCTGCGAAACTGAACGGTATCAAGAAGCGCGGCCTGAGCCCCAAGTTCCGCGAGCACCACAACCAGGCTCAACTCTTCTACAACTCTCTCTCCGAGCACGAGAAGGTCCAC
GTCAAGAAGGCCTTCGGCTTCGAACTGGACCACTGCGACGACCCCATCGTCTACGAGCGCCTCGCCGGCCACCGTCTCGCCGAGATCGATCTCACTCTCGCCCAGGAAGTCGCCGAGCTC
GTCGGCGCCCCGATCCCAGACAAGGCACTTCGCCCGAACCATGGAAAGCGCAGCAAGCATCTTTCGCAGACCGAGTTCCCGGGTAAGCAGCCGACGATCGCCAGTCGCCGAATCGCCATC
ATTATCGGCGACGGATACGACCCCGTCGCTTTCAATGGCCTCAAGGGCGCCATCACGGCGGTTGGAGCCTTACCTTTCGTCATTGGCACCAAGCGGTCACCTATCTACGCCGACGGTGAG
GACAAATCATCTTCCAAGGGCGTGATCGCCGACCACCAGTATGACGGACAGCGCTCGACGATGTTTGACGCTACCTTCATCCCTGGCGGTCCGCACGTCGAAAGCCTCAAGGCCAATGGC
CAGATCCGGTACTGGATCATTGAGACATTCGGTCATCTCAAGGCTCTGGGCGCCACTGGTGAAGCGGCGGCTTTCATCAAGGAAGCCCTGGGCTCCGCGCTTGATGTGAAGGTCGCTACG
TCTGATAACCCCCAGCCGGTTGAGTGGTATGGTGTTGTCACGGCTGGAAAGATCCACAAACCTGAGAGCTTCAAGGAAGGTATCCAGATTGTCAAGGATGCGAAGGATTTCATTAGCACC
TTCTTCTACCAGATCAGTCAGCATCGGAACTACAAGCGTGAACTGGATGGCCTCGCCTCGACAGTTGCATTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATATTGTGGCTGGGGGCCTCCACAAGGTTCAAGAAGCAGTGCAGGGCGCTGCTTCCAAGGATAAGAAGCTAGTTGACCTAGCACCCGACACCCATAATGTACAGTCCAGCAAG
GAGCCACTGACCACCGACCATGGTGTGCGTATCAGCGATACGGACCACTGGCTGAAGGAGGTGAATGACAATCACACCGGTCCTATGATGCTTGAGGACCAGATTGCACGAGAGAAG
ATT
CATCGTTTCGATCATGAGCGCATTCCCGAGAGAGTCGTCCATGCGCGTGGCACCGCTGCATTCGGAAACTTCAAGCTCCATGAGAGCGCTGAAGATGTATCCTACGCTGGTATCTTGACG
GATACCTCAAGGAACACTCCGGTTTTCCTTCGTTTCTCCACGGTCCAGGGCAGTAAAGGAAGTGCCGACACCGTCCGTGACGTTCGTGGGTTTGCCGTGAAATTCTACACCGACGAAGGA
AATTGGGATCTGGTTGGAAACAACATCCCCGTTTTCTTTATCCAAGATGCGATTAAGTTCCCGGATTTTG
TCCATGCTGTTAAGCCCGAGCCGCACAACGAGGTACCACAGGCCCAAACT
GCTCACAACAACTTCTGGGACTTTGTCTATCTTCACCCGGAAGCCACCCATATGTTCATGTGGGCCATGTCTGATCGGGCCATTCCTCGGTCATACCGTATGATGCAGGGTTTCGGTGTC
AACACATTCAGTCTCATCAACAAGGAAGGAAAGCGCCATTTTGTCAAGTTCCATTTCATCCCCCACCTGGGAGTGCACTCTTTGGTGTGGGACGAGGCTCTGAAACTGGCTGGCCAGGAC
CCCGATTTCCATCGCAAGGATCTCATGGAGGCCATTGATAACGGCGCATACCCGAAATGGGACTTCGCCATCCAGGTCATCCCTGAGGAGAAACAGGATGACTTCGAATTTGACATTTTC
GACGCGACGAAGATCTGGCCCGAGGAGCTCGTGCCTCTGCGCGTGATCGGCGAACTGGAACTGAACCGCAACGTCGACGAGTTCTTCCCTCAAACCGAGCAAGTCGCCTTCTGCACCAGC
CACATCGTCCCCGGCATTGACTTCAGTGACGACCCGCTTCTCCAGGGCCGTAACTTCTCCTACTTCGACACTCAGATCAGTCGACTGGGCATCAACTGGGAAGAAATCCCCATCAACCGC
CCCGTCTGCCCCGTTCTGAACCACAACCGAGACGGCGCCAAACGCCACCGCATCGCCCAGGGCACTGTCAACTACTGGCCGAACCGGTTTGAGGCCGGACCACCCGCACCAGTAGAACAA
GGTGGCTTCGCGTCCTACCCTGCGAAACTGAACGGTATCAAGAAGCGCGGCCTGAGCCCCAAGTTCCGCGAGCACCACAACCAGGCTCAACTCTTCTACAACTCTCTCTCCGAGCACGAG
AAGGTCCACGTCAAGAAGGCCTTCGGCTTCGAACTGGACCACTGCGACGACCCCATCGTCTACGAGCGCCTCGCCGGCCACCGTCTCGCCGAGATCGATCTCACTCTCGCCCAGGAAGTC
GCCGAGCTCGTCGGCGCCCCGATCCCAGACAAGGCACTTCGCCCGAACCATGGAAAGCGCAGCAAGCATCTTTCGCAGACCGAGTTCCCGGGTAAGCAGCCGACGATCGCCAGTCGCCGA
ATCGCCATCATTATCGGCGACGGATACGACCCCGTCGCTTTCAATGGCCTCAAGGGCGCCATCACGGCGGTTGGAGCCTTACCTTTCGTCATTGGCACCAAGCGGTCACCTATCTACGCC
GACGGTGAGGACAAATCATCTTCCAAGGGCGTGATCGCCGACCACCAGTATGACGGACAGCGCTCGACGATGTTTGACGCTACCTTCATCCCTGGCGGTCCGCACGTCGAAAGCCTCAAG
GCCAATGGCCAGATCCGGTACTGGATCATTGAGACATTCGGTCATCTCAAGGCTCTGGGCGCCACTGGTGAAGCGGCGGCTTTCATCAAGGAAGCCCTGGGCTCCGCGCTTGATGTGAAG
GTCGCTACGTCTGATAACCCCCAGCCGGTTGAGTGGTATGGTGTTGTCACGGCTGGAAAGATCCACAAACCTGAGAGCTTCAAGGAAGGTATCCAGATTGTCAAGGATGCGAAGGATTTC
ATTAGCACCTTCTTCTACCAGATCAGTCAGCATCGGAACTACAAGCGTGAACTGGATGGCCTCGCCTCGACAGTTGCATTCTAA

Retrieve as FASTA