Entry information : PnoKat02 (SNOG_14133)
Entry ID 5206
Creation 2007-04-14 (Marcel Zamocky)
Last sequence changes 2007-04-14 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoKat02 (SNOG_14133)
Name (synonym) PnoKat02 (SNOG_14133)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoKat02
start..stop
S start..stop
CheKat02_C5 1344 0 1..743 1..740
CheKat02_C4 1344 0 1..743 1..740
PtritKat01 1328 0 1..743 1..740
CfulKat02 1133 0 26..743 25..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 95724..95963 240 N° 2 95293..95674 382 N° 3 93475..95084 1610  
complement(join(93475..95084,95293..95674,95724..95963))


exon

Literature and cross-references PnoKat02 (SNOG_14133)
Literature The Broad Institute Genome Sequencing Platform. Birren B., Lander E., Galagan J., Devon K., Nusbaum C., Jaffe D., Butler J., Alvarez P., Gnerre S., Grabherr M., Kleber M., Mauceli E., Brockman W., Rounsley S., Young S., LaButti K., Pushparaj V., DeCaprio D., Crawford M., Solomon P. Annotation of the Phaeosphaeria nodorum SN15 genome. Submitted (MAR-2005) to the EMBL/GenBank/DDBJ databases.
Protein ref. UniProtKB:   Q0U1W6
DNA ref. JGI genome:   scaffold_30 (95963..93475)
Protein sequence: PnoKat02 (SNOG_14133)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   743
PWM (Da):   %s   82994.27  
PI (pH):   %s   6.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASQILATASHVADKAKEMTGVKNAKVAQLQADTKDVHDPKWKMTSDYGVKQNNTDDWLKVATEDQQGPMLLEDHFAREKIQRFDHERIPERVVHARGSGAFGKFTLFESAADVTSAGVLTDTSRETPVFLRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDIVGNNIPVFFIQDSMKFPDVIHAGKPEPDNEMPQAQSAHNNFWDFQYMHPEATHMFFWAMSDRTIPRSYRMMQGFGVNTFTLTNDKGERSFVKFIFTPELGVHSFVWDEALKIAGQDPDFHRKDLWTAIENGAYPKWKFGIQVIPESKEHDFEFDILDATKVWPEELVPIRYIGQLELNKNPDEFFTQTEQVAFCTGHVVPGIGFSDDPLLQGRNFSYNDTQLSRLGVNWQELPINKPVCPVMNFNRDGAMRHGITKGKVNYWPNRFESAPPAKASEGAYIDFPAKVAGIKARTQSKKFREHKNQAELFYNSLSEPEKMHAMNAFAFELDHCDDPLVYNRICERLCEIDLELAQKVSEMVGGDIPTTQTRTKHNKTAKGLSQLDFPPEKPTIATRMVAIIIADGYDKVAYEGIKAALTAAGALPFTISPRRNNIFAEGEDKSSGGVKADHHLEGMRSTMFDSVFVPGGAKSVETLSKNGRAIHWVREAFGHLKAIGATGEAVAFVKQCVDLPDMQFSTAGDVVESYGVVTASKVQPENFKETLQMAKGAKDFVSAYAFAISQHKNFDRELAGLNAMVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGCAAATTCTCGCAACCGCCTCCCACGTTGCAGACAAGGCTAAAGAGATGACGGGAGTCAAGAACGCAAAGGTCGCGCAGCTCCAGGCTGACACCAAGGATGTTCACGACCCC
AAATGGAAGATGACGAGCGACTATGGTGTCAAGCAGAACAACACGGACGACTGGCTGAAGGTCGCGACCGAGGACCAGCAGGGGCCTATGCTCCTGGAAGACCACTTCGCACGTGAGAAG
GTATGTGACATTGCACCAGGCGGCAACAGTAAAACACTGACATCTGCAGATCCAACGGTTCGACCACGAGCGCATTCCCGAGCGCGTCGTCCACGCCCGTGGTTCCGGCGCATTCGGAAA
GTTCACCCTCTTCGAATCCGCAGCCGACGTCACATCAGCCGGCGTGCTCACTGACACATCGCGTGAGACACCTGTCTTCCTGCGCTTCTCGACTGTCCTCGGTAGCCGTGGTTCCGCTGA
CACTGTTCGCGATGTCCGCGGTTTCGCCGTCAAGTTCTATACCGAAGAGGGCAATTGGGACATCGTTGGCAACAACATTCCCGTCTTCTTCATACAGGACTCTATGAAGTTTCCAGACGT
AATTCATGCTGGAAAGCCGGAGCCTGATAATGAGATGCCTCAGGCACAGTCGGCGCATAACAATTTCTGGG
GTGAGTTTTTGGTCCCATGAGAGTTCGCACCAACGAGTACCCGATGATT
TTTGCCCCCTCTCCTCAAAGTTCTGTCCTTTTTAGAGATTCGTGAATAGATTCAAGGATCTTTCGGGGCCCTGTGGGGTATTGGGGTGGCCTTAGGTGTATACAGCCTCGACTATCGACA
TCACGTTTTGCCATGAAACATGCACTAATTCCTTGCTAGACTTCCAGTACATGCACCCCGAGGCAACCCACATGTTCTTCTGGGCCATGTCGGACCGGACGATTCCTCGCTCGTACCGTA
TGATGCAGGGTTTCGGTGTCAACACCTTCACACTCACCAACGACAAGGGCGAGAGGAGTTTTGTCAAGTTCATTTTCACCCCCGAGTTGGGTGTACACAGCTTCGTGTGGGACGAGGCGC
TCAAGATCGCTGGTCAGGACCCTGACTTTCACCGCAAGGATCTGTGGACGGCGATTGAAAACGGCGCATATCCCAAGTGGAAGTTTGGCATCCAGGTCATCCCAGAGTCCAAGGAGCACG
ATTTCGAGTTCGATATCCTCGATGCTACCAAAGTGTGGCCTGAGGAGCTCGTGCCCATCAGGTACATTGGTCAGCTGGAGCTAAACAAGAACCCCGATGAGTTCTTCACTCAGACGGAAC
AGGTCGCATTTTGCACCGGCCATGTTGTCCCTGGTATTGGATTCAGCGATGATCCGCTACTACAGGGCCGTAACTTTTCATACAACGACACTCAACTCTCTCGTCTGGGTGTCAATTGGC
AAGAGCTGCCTATCAACAAACCTGTATGCCCCGTTATGAACTTCAACCGCGATGGAGCCATGCGCCACGGTATCACTAAGGGCAAGGTCAACTATTGGCCAAATCGCTTCGAATCTGCAC
CTCCCGCCAAGGCAAGCGAGGGCGCATACATCGACTTCCCCGCGAAGGTAGCCGGTATCAAGGCTCGAACACAGAGCAAGAAGTTCCGCGAACATAAGAATCAGGCTGAGTTGTTCTACA
ACTCGCTCTCTGAGCCCGAAAAGATGCACGCTATGAATGCGTTCGCCTTCGAGCTTGACCATTGCGACGACCCTCTGGTCTACAATCGCATCTGCGAGCGCCTCTGCGAGATCGATCTCG
AGCTCGCTCAGAAAGTCTCGGAGATGGTTGGAGGCGACATTCCCACGACACAAACGCGAACGAAACACAATAAGACAGCGAAGGGCCTCTCGCAGTTGGATTTCCCACCGGAGAAGCCCA
CCATCGCGACTCGCATGGTAGCCATCATTATTGCCGACGGGTACGACAAGGTCGCCTACGAGGGTATCAAGGCCGCCCTGACGGCCGCCGGTGCTCTCCCCTTCACTATAAGCCCTAGGA
GAAACAACATCTTCGCCGAGGGTGAGGACAAGTCATCCGGCGGTGTGAAGGCCGACCACCACCTTGAAGGCATGCGCTCCACCATGTTCGATAGCGTCTTCGTCCCCGGCGGCGCCAAGT
CCGTCGAGACACTCAGCAAGAACGGCCGCGCGATCCACTGGGTCCGCGAAGCATTCGGCCACTTGAAAGCCATCGGCGCCACTGGCGAGGCTGTTGCCTTCGTCAAGCAGTGCGTCGATC
TCCCTGACATGCAGTTCTCGACTGCAGGCGATGTTGTGGAGAGCTACGGCGTTGTTACGGCTAGCAAGGTGCAGCCTGAGAACTTCAAGGAGACGCTGCAGATGGCGAAGGGCGCGAAGG
ACTTTGTGAGCGCGTATGCGTTTGCCATCTCGCAGCATAAGAACTTTGATCGTGAGTTGGCGGGACTGAATGCTATGGTCGCATATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCGCAAATTCTCGCAACCGCCTCCCACGTTGCAGACAAGGCTAAAGAGATGACGGGAGTCAAGAACGCAAAGGTCGCGCAGCTCCAGGCTGACACCAAGGATGTTCACGACCCC
AAATGGAAGATGACGAGCGACTATGGTGTCAAGCAGAACAACACGGACGACTGGCTGAAGGTCGCGACCGAGGACCAGCAGGGGCCTATGCTCCTGGAAGACCACTTCGCACGTGAGAAG
ATCCAACGGTTCGACCACGAGCGCATTCCCGAGCGCGTCGTCCACGCCCGTGGTTCCGGCGCATTCGGAAAGTTCACCCTCTTCGAATCCGCAGCCGACGTCACATCAGCCGGCGTGCTC
ACTGACACATCGCGTGAGACACCTGTCTTCCTGCGCTTCTCGACTGTCCTCGGTAGCCGTGGTTCCGCTGACACTGTTCGCGATGTCCGCGGTTTCGCCGTCAAGTTCTATACCGAAGAG
GGCAATTGGGACATCGTTGGCAACAACATTCCCGTCTTCTTCATACAGGACTCTATGAAGTTTCCAGACGTAATTCATGCTGGAAAGCCGGAGCCTGATAATGAGATGCCTCAGGCACAG
TCGGCGCATAACAATTTCTGGG
ACTTCCAGTACATGCACCCCGAGGCAACCCACATGTTCTTCTGGGCCATGTCGGACCGGACGATTCCTCGCTCGTACCGTATGATGCAGGGTTTCGGT
GTCAACACCTTCACACTCACCAACGACAAGGGCGAGAGGAGTTTTGTCAAGTTCATTTTCACCCCCGAGTTGGGTGTACACAGCTTCGTGTGGGACGAGGCGCTCAAGATCGCTGGTCAG
GACCCTGACTTTCACCGCAAGGATCTGTGGACGGCGATTGAAAACGGCGCATATCCCAAGTGGAAGTTTGGCATCCAGGTCATCCCAGAGTCCAAGGAGCACGATTTCGAGTTCGATATC
CTCGATGCTACCAAAGTGTGGCCTGAGGAGCTCGTGCCCATCAGGTACATTGGTCAGCTGGAGCTAAACAAGAACCCCGATGAGTTCTTCACTCAGACGGAACAGGTCGCATTTTGCACC
GGCCATGTTGTCCCTGGTATTGGATTCAGCGATGATCCGCTACTACAGGGCCGTAACTTTTCATACAACGACACTCAACTCTCTCGTCTGGGTGTCAATTGGCAAGAGCTGCCTATCAAC
AAACCTGTATGCCCCGTTATGAACTTCAACCGCGATGGAGCCATGCGCCACGGTATCACTAAGGGCAAGGTCAACTATTGGCCAAATCGCTTCGAATCTGCACCTCCCGCCAAGGCAAGC
GAGGGCGCATACATCGACTTCCCCGCGAAGGTAGCCGGTATCAAGGCTCGAACACAGAGCAAGAAGTTCCGCGAACATAAGAATCAGGCTGAGTTGTTCTACAACTCGCTCTCTGAGCCC
GAAAAGATGCACGCTATGAATGCGTTCGCCTTCGAGCTTGACCATTGCGACGACCCTCTGGTCTACAATCGCATCTGCGAGCGCCTCTGCGAGATCGATCTCGAGCTCGCTCAGAAAGTC
TCGGAGATGGTTGGAGGCGACATTCCCACGACACAAACGCGAACGAAACACAATAAGACAGCGAAGGGCCTCTCGCAGTTGGATTTCCCACCGGAGAAGCCCACCATCGCGACTCGCATG
GTAGCCATCATTATTGCCGACGGGTACGACAAGGTCGCCTACGAGGGTATCAAGGCCGCCCTGACGGCCGCCGGTGCTCTCCCCTTCACTATAAGCCCTAGGAGAAACAACATCTTCGCC
GAGGGTGAGGACAAGTCATCCGGCGGTGTGAAGGCCGACCACCACCTTGAAGGCATGCGCTCCACCATGTTCGATAGCGTCTTCGTCCCCGGCGGCGCCAAGTCCGTCGAGACACTCAGC
AAGAACGGCCGCGCGATCCACTGGGTCCGCGAAGCATTCGGCCACTTGAAAGCCATCGGCGCCACTGGCGAGGCTGTTGCCTTCGTCAAGCAGTGCGTCGATCTCCCTGACATGCAGTTC
TCGACTGCAGGCGATGTTGTGGAGAGCTACGGCGTTGTTACGGCTAGCAAGGTGCAGCCTGAGAACTTCAAGGAGACGCTGCAGATGGCGAAGGGCGCGAAGGACTTTGTGAGCGCGTAT
GCGTTTGCCATCTCGCAGCATAAGAACTTTGATCGTGAGTTGGCGGGACTGAATGCTATGGTCGCATATTAG

Retrieve as FASTA