Entry information : NcKat01 (cat-1)
Entry ID 5207
Creation 2007-04-14 (Marcel Zamocky)
Last sequence changes 2007-04-14 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-25 (Catherine Mathe (Scipio))
Peroxidase information: NcKat01 (cat-1)
Name (synonym) NcKat01 (cat-1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora crassa    [TaxId: 5141 ]
Cellular localisation Peroxisomal
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NcKat01
start..stop
S start..stop
PanKat01 1214 0 10..736 9..736
CgKat01 1203 0 1..736 1..737
CtheKat01 1171 0 1..736 39..776
CgraKat01 1118 0 1..736 1..742
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5112094..5112324 231 N° 2 5112386..5114365 1980  
join(5112094..5112324,5112386..5114365)


exon

Literature and cross-references NcKat01 (cat-1)
Literature Diaz A., Rangel P., Montes de Oca Y., Lledias F., Hansberg W.;
"Molecular and kinetic study of catalase-1, a durable large catalase of Neurospora crassa.";
Free Radic. Biol. Med. 31:1323-1333(2001).
Protein ref. UniProtKB:   Q9C168
DNA ref. JGI genome:   supercont10.3 (5112094..5114365)
Cluster/Prediction ref. UniGene:   Ncr.12809
Protein sequence: NcKat01 (cat-1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   736
PWM (Da):   %s   82053.33  
PI (pH):   %s   6.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNIISQAGQKAKEALTSAPSSKKVDDLKNEFKETDKSARLTTDYGVKQTTADDWLRIVSDDKIGPSLLEDPFARERIMRFDHERIPERVVHARGSGAFGKFKVYESASDLTMAPVLTDTSRETPVFVRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDLVGNNIPVFFIQDAIKFPDVIHAGKPEPHNEVPQAQSAHNNFWDFQFNHTEATHMFTWAMSDRAIPRSLRMMQGFGVNTYTLINAQGKRHFVKFHWTPELGVHSLVWDEALKLAGQDPDFHRKDLWEAIENGAYPKWKFGIQAIAEEDEHKFDFDILDATKIWPEDLVPVRYIGEMELNRNPDEFFPQTEQIAFCTSHVVNGIGFSDDPLLQGRNFSYFDTQISRLGVNFQELPINRPVCPVMNFNRDGAMRHTISRGTVNYYPNRFDACPPASLKEGGYLEYAQKVAGIKARARSAKFKEHFSQAQLFYNSMSPIEKQHMINAFGFELDHCEDPVVYGRMVQRLADIDLGLAQTIAEMVGGEAPTTTNHPNHGRKTINLSQTEFPPATPTIKSRRVAIIIADGYDNVAYDAAYAAISANQAIPLVIGPRRSKVTAANGSTVQPHHHLEGFRSTMVDAIFIPGGAKAAETLSKNGRALHWIREAFGHLKAIGATGEAVDLVAKAIALPQVTVSSEAEVHESYGVVTLKKVKPESFTDAVKIAKGAAGFLGEFFYAIAQHRNWDRELDGLHSMIAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo III, 1 intron) and 4 ESTs. Strain="ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAACATCATCAGCCAGGCCGGCCAAAAGGCCAAGGAGGCCCTCACCAGTGCCCCCAGCAGCAAGAAGGTGGACGATCTCAAGAACGAGTTCAAGGAGACCGATAAGAGTGCCCGC
CTCACCACCGACTATGGTGTCAAGCAGACCACGGCCGACGACTGGCTGAGGATCGTCAGCGACGACAAGATTGGTCCTTCGTTGCTCGAGGACCCCTTTGCCCGTGAAAGG
GTACGTATC
CCATCCTACTAACACTTTTCTGCCCGTATCGCGGCTAACAACATTCTTTCAGATCATGCGCTTCGACCACGAGAGAATCCCAGAGCGAGTAGTCCACGCCCGTGGCAGCGGTGCCTTTGG
CAAGTTCAAGGTCTACGAGAGCGCCTCCGACCTCACAATGGCCCCTGTCCTTACCGATACTTCGCGCGAGACTCCCGTCTTTGTGCGCTTCTCTACCGTTCTCGGCAGTCGAGGCAGTGC
CGACACGGTCCGTGATGTCCGTGGTTTCGCCGTCAAGTTCTACACAGAGGAGGGCAACTGGGATCTGGTCGGCAACAATATCCCCGTCTTCTTCATCCAGGATGCCATCAAGTTCCCCGA
TGTCATCCACGCTGGCAAGCCCGAGCCCCACAACGAGGTGCCCCAGGCCCAGAGCGCCCACAACAACTTTTGGGATTTCCAGTTCAACCACACCGAGGCCACTCACATGTTCACCTGGGC
CATGAGTGATCGCGCCATTCCCCGTTCCCTCCGCATGATGCAGGGTTTCGGTGTCAACACCTACACTCTCATCAACGCCCAGGGCAAGCGTCACTTTGTCAAGTTCCACTGGACTCCCGA
GCTCGGTGTCCACTCCCTCGTTTGGGATGAGGCCTTGAAGCTGGCTGGTCAGGATCCCGATTTCCACCGCAAGGATCTTTGGGAGGCTATCGAGAACGGTGCCTACCCCAAGTGGAAGTT
TGGTATCCAGGCTATTGCCGAGGAGGACGAGCACAAGTTCGACTTTGACATCCTCGATGCCACCAAGATCTGGCCCGAGGACCTCGTTCCCGTCCGTTACATTGGTGAGATGGAGCTTAA
CCGCAACCCGGACGAGTTCTTCCCCCAGACCGAGCAGATCGCCTTCTGCACCAGCCACGTCGTCAACGGTATTGGCTTCTCGGACGACCCTCTTCTCCAGGGCCGTAACTTTTCCTACTT
TGACACCCAGATCTCCCGTCTTGGTGTCAACTTCCAGGAGCTGCCCATCAACCGCCCTGTGTGCCCTGTCATGAACTTTAACCGTGATGGTGCCATGCGCCACACCATCTCCCGCGGCAC
CGTCAACTACTACCCCAACCGTTTCGACGCCTGCCCTCCCGCCTCCCTCAAGGAAGGCGGTTACCTCGAGTACGCCCAGAAGGTCGCCGGTATCAAGGCCCGCGCCCGCAGCGCCAAGTT
TAAGGAGCACTTCAGCCAGGCCCAGCTCTTCTACAACTCGATGTCGCCAATTGAGAAGCAGCACATGATCAACGCTTTTGGCTTCGAGCTCGACCACTGCGAGGATCCTGTTGTCTACGG
CCGCATGGTTCAGCGTCTGGCCGACATCGATCTTGGTCTTGCTCAGACCATTGCCGAAATGGTTGGCGGCGAGGCTCCCACTACCACCAACCACCCTAACCACGGCAGGAAGACCATCAA
CCTCAGCCAGACCGAGTTCCCGCCTGCGACCCCAACCATCAAGTCCCGCCGTGTTGCCATCATCATCGCCGATGGCTACGATAACGTCGCTTATGACGCTGCCTATGCCGCTATTTCTGC
CAACCAGGCCATCCCTCTTGTTATCGGCCCCCGCCGTTCCAAGGTCACTGCTGCCAATGGCTCGACCGTCCAGCCCCACCACCACCTCGAGGGCTTCCGTTCGACCATGGTGGACGCCAT
CTTCATCCCCGGCGGCGCCAAGGCTGCTGAGACGCTCTCCAAGAACGGCCGTGCTCTGCACTGGATCCGTGAGGCGTTTGGTCATCTCAAGGCCATTGGTGCTACCGGCGAGGCGGTTGA
CCTCGTTGCCAAGGCGATTGCTCTGCCTCAGGTCACAGTCAGCAGCGAGGCGGAGGTTCATGAAAGCTATGGTGTTGTGACGCTCAAGAAGGTTAAGCCTGAGAGCTTCACAGATGCCGT
CAAGATTGCCAAGGGCGCTGCTGGGTTCTTGGGAGAGTTCTTCTATGCCATTGCCCAGCACAGGAATTGGGACAGAGAGTTGGATGGCTTGCACTCCATGATTGCGTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAACATCATCAGCCAGGCCGGCCAAAAGGCCAAGGAGGCCCTCACCAGTGCCCCCAGCAGCAAGAAGGTGGACGATCTCAAGAACGAGTTCAAGGAGACCGATAAGAGTGCCCGC
CTCACCACCGACTATGGTGTCAAGCAGACCACGGCCGACGACTGGCTGAGGATCGTCAGCGACGACAAGATTGGTCCTTCGTTGCTCGAGGACCCCTTTGCCCGTGAAAGG
ATCATGCGC
TTCGACCACGAGAGAATCCCAGAGCGAGTAGTCCACGCCCGTGGCAGCGGTGCCTTTGGCAAGTTCAAGGTCTACGAGAGCGCCTCCGACCTCACAATGGCCCCTGTCCTTACCGATACT
TCGCGCGAGACTCCCGTCTTTGTGCGCTTCTCTACCGTTCTCGGCAGTCGAGGCAGTGCCGACACGGTCCGTGATGTCCGTGGTTTCGCCGTCAAGTTCTACACAGAGGAGGGCAACTGG
GATCTGGTCGGCAACAATATCCCCGTCTTCTTCATCCAGGATGCCATCAAGTTCCCCGATGTCATCCACGCTGGCAAGCCCGAGCCCCACAACGAGGTGCCCCAGGCCCAGAGCGCCCAC
AACAACTTTTGGGATTTCCAGTTCAACCACACCGAGGCCACTCACATGTTCACCTGGGCCATGAGTGATCGCGCCATTCCCCGTTCCCTCCGCATGATGCAGGGTTTCGGTGTCAACACC
TACACTCTCATCAACGCCCAGGGCAAGCGTCACTTTGTCAAGTTCCACTGGACTCCCGAGCTCGGTGTCCACTCCCTCGTTTGGGATGAGGCCTTGAAGCTGGCTGGTCAGGATCCCGAT
TTCCACCGCAAGGATCTTTGGGAGGCTATCGAGAACGGTGCCTACCCCAAGTGGAAGTTTGGTATCCAGGCTATTGCCGAGGAGGACGAGCACAAGTTCGACTTTGACATCCTCGATGCC
ACCAAGATCTGGCCCGAGGACCTCGTTCCCGTCCGTTACATTGGTGAGATGGAGCTTAACCGCAACCCGGACGAGTTCTTCCCCCAGACCGAGCAGATCGCCTTCTGCACCAGCCACGTC
GTCAACGGTATTGGCTTCTCGGACGACCCTCTTCTCCAGGGCCGTAACTTTTCCTACTTTGACACCCAGATCTCCCGTCTTGGTGTCAACTTCCAGGAGCTGCCCATCAACCGCCCTGTG
TGCCCTGTCATGAACTTTAACCGTGATGGTGCCATGCGCCACACCATCTCCCGCGGCACCGTCAACTACTACCCCAACCGTTTCGACGCCTGCCCTCCCGCCTCCCTCAAGGAAGGCGGT
TACCTCGAGTACGCCCAGAAGGTCGCCGGTATCAAGGCCCGCGCCCGCAGCGCCAAGTTTAAGGAGCACTTCAGCCAGGCCCAGCTCTTCTACAACTCGATGTCGCCAATTGAGAAGCAG
CACATGATCAACGCTTTTGGCTTCGAGCTCGACCACTGCGAGGATCCTGTTGTCTACGGCCGCATGGTTCAGCGTCTGGCCGACATCGATCTTGGTCTTGCTCAGACCATTGCCGAAATG
GTTGGCGGCGAGGCTCCCACTACCACCAACCACCCTAACCACGGCAGGAAGACCATCAACCTCAGCCAGACCGAGTTCCCGCCTGCGACCCCAACCATCAAGTCCCGCCGTGTTGCCATC
ATCATCGCCGATGGCTACGATAACGTCGCTTATGACGCTGCCTATGCCGCTATTTCTGCCAACCAGGCCATCCCTCTTGTTATCGGCCCCCGCCGTTCCAAGGTCACTGCTGCCAATGGC
TCGACCGTCCAGCCCCACCACCACCTCGAGGGCTTCCGTTCGACCATGGTGGACGCCATCTTCATCCCCGGCGGCGCCAAGGCTGCTGAGACGCTCTCCAAGAACGGCCGTGCTCTGCAC
TGGATCCGTGAGGCGTTTGGTCATCTCAAGGCCATTGGTGCTACCGGCGAGGCGGTTGACCTCGTTGCCAAGGCGATTGCTCTGCCTCAGGTCACAGTCAGCAGCGAGGCGGAGGTTCAT
GAAAGCTATGGTGTTGTGACGCTCAAGAAGGTTAAGCCTGAGAGCTTCACAGATGCCGTCAAGATTGCCAAGGGCGCTGCTGGGTTCTTGGGAGAGTTCTTCTATGCCATTGCCCAGCAC
AGGAATTGGGACAGAGAGTTGGATGGCTTGCACTCCATGATTGCGTACTAA

Retrieve as FASTA