Entry information : AnKat01 (catA)
Entry ID 5214
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2007-04-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AnKat01 (catA)
Name (synonym) AnKat01 (catA)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus niger    [TaxId: 5061 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AnKat01
start..stop
S start..stop
NfKat01 1287 0 1..748 1..746
AfumKat01 1277 0 1..748 1..750
AorKat01 1269 0 1..748 1..747
AclKat01 1264 0 1..748 1..746
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 743410..743643 234 N° 2 743038..743350 313 N° 3 741286..742985 1700  
complement(join(741286..742985,743038..743350,743410..743643))


exon

Literature and cross-references AnKat01 (catA)
Literature Navarro R.E., Stringer M.A., Hansberg W., Timberlake W.E., Aguirre J. catA, a new Aspergillus nidulans gene encoding a developmentally regulated catalase. Curr. Genet. 29:352-359(1996).
Protein ref. UniProtKB:   A2QTS7
DNA ref. JGI genome:   chr_1_1 (743643..741286)
Protein sequence: AnKat01 (catA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   748
PWM (Da):   %s   83987.3  
PI (pH):   %s   6.43
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATVIAGGLEKAHEAVKSASSKNKKTVDLERDLVDVTTEQRQTTDHGVLISNTDNWLRSVDDHRTGPSLLEDQIAREKIHRFDHERIPERVVHARGTGAFGNFKLLESCEDVTYAKVLTDTSRNTPVFVRFSTVQGSKGSADTVRDVRGFATKFYTDEGNWDLVGNNIPVFFIQDAIKFTDFVHAVKPEPHNEVPQAQTAHNNFWDFCYLHPEATHMFMWAMSDRAIPRSYRMMQGFGVNTFSLINKEGKRHFVKFIWTPHLGVHSFVWDEALKLAGQDPDFHRKDLMEAIDNGAYPKWDLSIQTIPEEKQDDFEFDILDATKIWPEDLVPPRTIGVLELNRNVDEFFPQTEQVAFCTSHIVPGIDFSDDPLLQGRNFSYFDTQISRLGINWEELPINRPVCPVLNHNRDGAMKHRITKGSVNYWPNRFEAAKPDEPAPQGGGFESYPEPVQGRKRRALSPKFREHHSQAQLFYNSMSEHEKLHIVKAFGFELDHCDDPIVYERMAGKRLAEIDLTLAQQVAEVVGAPIPQKALMANHGRKTIHVSQTEFPPKSPTIASRRIAIVIGDGYDPVAFKGIQTAVKVAGALPFVIGTKRSPIYADGELKETSQGIIADHQYDGQRSTMFDATFIPGGPHVETLRKNGQMRYWIAETFGHLKPLAGTGEAAELIKEALGSVLDVQVATSSNPQPVEWYGVVTAGGVQKPESFKESVQIAKGAKDFVGMFFYQIAQHRNYQRELDGLSSTVAW

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns) and 2 ESTs (BE758885, DR699103). Strain="CBS 513.88" and "N400". Commercially available from Sigma.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACGGTCATTGCCGGAGGGCTTGAAAAGGCTCACGAAGCCGTCAAGTCGGCCTCTTCTAAAAACAAGAAGACGGTCGACTTGGAGCGCGACCTGGTCGATGTCACCACCGAGCAG
CGTCAGACCACCGACCACGGCGTGCTCATCAGCAATACCGACAACTGGCTGCGGTCAGTCGACGACCATCGCACTGGTCCATCGTTGCTAGAGGATCAGATTGCGCGCGAGAAG
GTACTT
CCATATGCCTGCGCTGATACAATGGAAATTTCAGACGGCTGATCGTATCCCAGATTCACCGATTCGACCACGAGCGGATTCCCGAGCGTGTCGTCCATGCCCGTGGAACCGGCGCTTTCG
GAAACTTCAAGCTACTCGAAAGCTGCGAGGACGTGACCTATGCCAAGGTTCTAACCGACACATCGCGGAACACACCAGTCTTCGTCCGCTTTTCCACCGTGCAGGGCAGCAAGGGAAGCG
CTGACACGGTGCGTGATGTTCGTGGGTTCGCAACCAAATTCTACACCGACGAGGGTAACTGGGACCTGGTCGGAAACAACATCCCGGTTTTCTTCATCCAGGATGCTATCAAGTTCACTG
ATTTCG
GTGCGTCCATCCCAATTCATTTCCGCATCCCTGACTTGACTAATTGGCGCAGTCCACGCTGTGAAGCCTGAACCCCATAATGAGGTCCCTCAAGCGCAGACCGCTCATAACAAC
TTCTGGGACTTTTGCTACTTGCACCCAGAAGCCACTCACATGTTCATGTGGGCCATGTCGGACCGTGCCATTCCCCGGTCCTATCGGATGATGCAAGGGTTTGGTGTCAACACCTTTTCG
CTTATCAACAAAGAGGGCAAGCGCCACTTTGTCAAGTTTATCTGGACGCCTCACCTAGGAGTACATTCATTCGTCTGGGATGAAGCTCTGAAGCTGGCGGGTCAAGATCCGGACTTCCAT
CGTAAGGATCTGATGGAGGCCATTGACAATGGCGCCTATCCAAAGTGGGATCTGTCTATCCAGACCATCCCTGAAGAGAAACAGGATGACTTCGAATTCGACATTCTCGATGCGACCAAG
ATCTGGCCAGAGGATCTGGTTCCGCCCCGCACCATTGGTGTGTTGGAGCTTAACCGCAACGTGGATGAATTCTTCCCACAGACAGAGCAGGTTGCATTCTGTACATCGCACATTGTTCCC
GGTATCGACTTCTCCGATGATCCTCTCCTCCAGGGTCGCAACTTTTCCTACTTCGACACCCAGATTAGCCGTCTCGGAATCAATTGGGAGGAGTTGCCCATCAATCGTCCCGTCTGTCCC
GTGCTAAACCACAACCGCGACGGTGCCATGAAACACCGCATCACCAAGGGTTCTGTCAACTACTGGCCCAACCGCTTCGAAGCGGCGAAGCCCGACGAGCCCGCTCCCCAAGGGGGTGGC
TTCGAGTCCTACCCAGAACCGGTACAAGGCCGCAAGAGGCGCGCGTTGAGCCCCAAGTTCCGCGAACACCACTCCCAGGCCCAACTTTTCTACAACTCCATGTCGGAGCACGAAAAGCTG
CACATCGTCAAGGCTTTCGGGTTCGAGCTGGACCACTGCGATGACCCTATCGTTTACGAGCGCATGGCCGGCAAGCGTCTGGCGGAGATTGACCTGACCCTGGCGCAGCAGGTGGCGGAA
GTCGTGGGCGCGCCGATTCCTCAGAAGGCCCTCATGGCCAACCACGGCCGGAAGACGATCCATGTTTCCCAGACTGAATTTCCCCCCAAGTCTCCGACCATCGCTAGTCGGCGCATTGCC
ATCGTGATTGGCGACGGATACGACCCGGTGGCATTCAAGGGAATTCAAACCGCCGTGAAGGTGGCAGGTGCTCTGCCGTTTGTCATCGGCACTAAGCGGTCACCCATTTATGCCGACGGA
GAATTGAAGGAGACGTCGCAGGGCATCATCGCCGACCACCAGTATGATGGACAGCGATCAACCATGTTCGATGCGACGTTCATTCCCGGTGGGCCTCATGTGGAGACGCTCCGCAAGAAT
GGACAGATGCGGTACTGGATTGCCGAGACATTTGGCCACCTGAAGCCACTGGCTGGTACGGGTGAAGCGGCGGAGCTAATCAAGGAGGCGCTGGGTAGCGTGCTGGACGTGCAAGTGGCC
ACCAGCTCCAACCCACAGCCCGTGGAATGGTATGGCGTGGTCACGGCCGGTGGCGTGCAGAAGCCGGAGAGCTTCAAGGAAAGCGTGCAGATCGCGAAGGGCGCCAAGGATTTCGTGGGC
ATGTTCTTCTACCAGATCGCGCAGCACCGGAACTACCAGCGCGAGTTGGATGGGCTGAGCTCGACGGTTGCCTGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACGGTCATTGCCGGAGGGCTTGAAAAGGCTCACGAAGCCGTCAAGTCGGCCTCTTCTAAAAACAAGAAGACGGTCGACTTGGAGCGCGACCTGGTCGATGTCACCACCGAGCAG
CGTCAGACCACCGACCACGGCGTGCTCATCAGCAATACCGACAACTGGCTGCGGTCAGTCGACGACCATCGCACTGGTCCATCGTTGCTAGAGGATCAGATTGCGCGCGAGAAG
ATTCAC
CGATTCGACCACGAGCGGATTCCCGAGCGTGTCGTCCATGCCCGTGGAACCGGCGCTTTCGGAAACTTCAAGCTACTCGAAAGCTGCGAGGACGTGACCTATGCCAAGGTTCTAACCGAC
ACATCGCGGAACACACCAGTCTTCGTCCGCTTTTCCACCGTGCAGGGCAGCAAGGGAAGCGCTGACACGGTGCGTGATGTTCGTGGGTTCGCAACCAAATTCTACACCGACGAGGGTAAC
TGGGACCTGGTCGGAAACAACATCCCGGTTTTCTTCATCCAGGATGCTATCAAGTTCACTGATTTCG
TCCACGCTGTGAAGCCTGAACCCCATAATGAGGTCCCTCAAGCGCAGACCGCT
CATAACAACTTCTGGGACTTTTGCTACTTGCACCCAGAAGCCACTCACATGTTCATGTGGGCCATGTCGGACCGTGCCATTCCCCGGTCCTATCGGATGATGCAAGGGTTTGGTGTCAAC
ACCTTTTCGCTTATCAACAAAGAGGGCAAGCGCCACTTTGTCAAGTTTATCTGGACGCCTCACCTAGGAGTACATTCATTCGTCTGGGATGAAGCTCTGAAGCTGGCGGGTCAAGATCCG
GACTTCCATCGTAAGGATCTGATGGAGGCCATTGACAATGGCGCCTATCCAAAGTGGGATCTGTCTATCCAGACCATCCCTGAAGAGAAACAGGATGACTTCGAATTCGACATTCTCGAT
GCGACCAAGATCTGGCCAGAGGATCTGGTTCCGCCCCGCACCATTGGTGTGTTGGAGCTTAACCGCAACGTGGATGAATTCTTCCCACAGACAGAGCAGGTTGCATTCTGTACATCGCAC
ATTGTTCCCGGTATCGACTTCTCCGATGATCCTCTCCTCCAGGGTCGCAACTTTTCCTACTTCGACACCCAGATTAGCCGTCTCGGAATCAATTGGGAGGAGTTGCCCATCAATCGTCCC
GTCTGTCCCGTGCTAAACCACAACCGCGACGGTGCCATGAAACACCGCATCACCAAGGGTTCTGTCAACTACTGGCCCAACCGCTTCGAAGCGGCGAAGCCCGACGAGCCCGCTCCCCAA
GGGGGTGGCTTCGAGTCCTACCCAGAACCGGTACAAGGCCGCAAGAGGCGCGCGTTGAGCCCCAAGTTCCGCGAACACCACTCCCAGGCCCAACTTTTCTACAACTCCATGTCGGAGCAC
GAAAAGCTGCACATCGTCAAGGCTTTCGGGTTCGAGCTGGACCACTGCGATGACCCTATCGTTTACGAGCGCATGGCCGGCAAGCGTCTGGCGGAGATTGACCTGACCCTGGCGCAGCAG
GTGGCGGAAGTCGTGGGCGCGCCGATTCCTCAGAAGGCCCTCATGGCCAACCACGGCCGGAAGACGATCCATGTTTCCCAGACTGAATTTCCCCCCAAGTCTCCGACCATCGCTAGTCGG
CGCATTGCCATCGTGATTGGCGACGGATACGACCCGGTGGCATTCAAGGGAATTCAAACCGCCGTGAAGGTGGCAGGTGCTCTGCCGTTTGTCATCGGCACTAAGCGGTCACCCATTTAT
GCCGACGGAGAATTGAAGGAGACGTCGCAGGGCATCATCGCCGACCACCAGTATGATGGACAGCGATCAACCATGTTCGATGCGACGTTCATTCCCGGTGGGCCTCATGTGGAGACGCTC
CGCAAGAATGGACAGATGCGGTACTGGATTGCCGAGACATTTGGCCACCTGAAGCCACTGGCTGGTACGGGTGAAGCGGCGGAGCTAATCAAGGAGGCGCTGGGTAGCGTGCTGGACGTG
CAAGTGGCCACCAGCTCCAACCCACAGCCCGTGGAATGGTATGGCGTGGTCACGGCCGGTGGCGTGCAGAAGCCGGAGAGCTTCAAGGAAAGCGTGCAGATCGCGAAGGGCGCCAAGGAT
TTCGTGGGCATGTTCTTCTACCAGATCGCGCAGCACCGGAACTACCAGCGCGAGTTGGATGGGCTGAGCTCGACGGTTGCCTGGTAA

Retrieve as FASTA