Entry information : FoKat01
Entry ID 5225
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2007-04-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoKat01
Name FoKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoKat01
start..stop
S start..stop
GzKat04 1000 0 1..577 1..549
CfulKat01 890 0 1..547 1..547
CnKat02_JEC21 790 0 19..544 160..681
CnKat02_grubiiH99 787 0 19..544 160..681
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1542194..1542637 444 N° 2 1542685..1542778 94 N° 3 1542833..1544031 1199  
join(1542194..1542637,1542685..1542778,1542833..1544031)


exon

Literature and cross-references FoKat01
Literature Broad Institute genome project, unpublished
DNA ref. JGI genome:   Supercontig_2.10 (1542194..1544031)
Protein sequence: FoKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   578
PWM (Da):   %s   65190.97  
PI (pH):   %s   6.72
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPSATDTSFAAHVASQFQSYETDRQASSKETLYTTSNGVPIAHPYETQRAGENGPLLLQDFHLIDLLSHFDRERIPERVVHAKGSGAHGYFECTDPLDDLCLADILSEKGKRCSVSMRFSTVGGESGSHDMARDPRGFSVKMRTDEGNWDMVFNNTPVFFLRDPAKFPHFIHTQKRDPSTHLTHADDSFMFWDYLSQNPESIHQVMILMGDRGIPKNYRQMHGYSGHTFKLINKAGEWVYCQIHLKSMQGVDFVTQEESADYSPDHSQKDLYEAIQNGDYPKWTLEVQTMTAKEAEELWEKQKINVFDLTHVWPQKQFPRRKVGEFTLNENAINYFAEVEQIAFNPSHLPPGVEPSADPVLQSRLFSYPDTHRHRLGVNYQQLPVNATRTGYQFGNFQRDGQMTFYNQGARPNYLSSIDPIKFRSRAVDLDKTHGHFTGEAITFLTEIRPEDFNAPRALWRNVFDEPARERFINNVTGKMKLCKQEEPLKRQIAIFREVDPEIAERLEKSTGIKGYDGISNMAFNGTHNGMASDGKNKLANGIVDKNKSPAARQGAPGSGAHGSLVTNGKSNGVNGH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2a, 3 exons). Contig Position: 166760-168594. Forma_specialis="lycopersici". Strain="4286".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCTTCAGCAACAGACACCTCCTTCGCAGCCCACGTAGCAAGCCAATTCCAATCCTACGAAACAGACCGTCAAGCCTCATCCAAAGAAACCCTCTACACCACCTCCAACGGCGTC
CCCATCGCCCATCCATATGAAACCCAACGAGCCGGTGAAAACGGGCCCCTTCTCCTACAAGACTTCCACCTGATCGATCTCCTCTCACACTTTGACCGCGAGCGTATTCCCGAGCGTGTT
GTTCACGCAAAGGGAAGTGGTGCGCATGGTTATTTTGAGTGTACGGACCCGCTGGATGATTTGTGCCTGGCGGATATCCTGTCGGAGAAGGGGAAGAGATGTTCTGTTAGTATGAGGTTT
TCGACGGTGGGTGGTGAGTCGGGATCGCATGATATGGCGAGAGATCCGAGGGGGTTTTCGGTTAAGATGAGGACTGATGAGGGT
GTAAGTGAATTCGTCATACAGTTGTGGTGAGATGCT
GATTTGTGCAGAATTGGGATATGGTCTTCAACAACACGCCTGTCTTCTTTTTGAGAGACCCGGCCAAGTTCCCTCACTTCATCCACACCCAGAAGCGAGACCCAAGTAAGTTTATTTATA
ATTTAATTAATGGGTATGATTATGGAGCTAACAAATAAGGCACTCATCTCACTCATGCCGACGATTCATTCATGTTCTGGGACTACCTCTCCCAGAACCCCGAATCAATCCACCAAGTCA
TGATCCTAATGGGTGACAGGGGGATTCCGAAGAATTACAGACAAATGCATGGTTATAGCGGTCACACCTTCAAGCTTATCAACAAGGCTGGCGAGTGGGTTTACTGTCAAATTCACCTCA
AGTCGATGCAGGGTGTCGACTTTGTCACCCAGGAAGAGTCAGCTGACTACTCCCCTGATCACTCGCAAAAGGATTTGTATGAAGCTATCCAGAATGGAGATTATCCTAAATGGACTCTTG
AAGTTCAGACTATGACTGCCAAGGAAGCTGAGGAGTTGTGGGAGAAGCAAAAGATCAACGTCTTTGACCTCACGCATGTCTGGCCTCAGAAGCAATTCCCTCGCCGCAAGGTCGGAGAGT
TCACACTCAACGAGAACGCAATCAACTACTTTGCGGAAGTTGAGCAGATTGCTTTCAATCCTTCTCATCTTCCTCCCGGTGTCGAGCCATCGGCCGATCCCGTTCTTCAATCCCGGTTGT
TCTCTTATCCGGATACCCATCGCCATCGTCTCGGTGTAAATTACCAGCAATTGCCTGTCAACGCAACACGCACAGGGTATCAATTCGGTAACTTCCAGCGTGACGGCCAAATGACATTCT
ATAACCAGGGTGCACGACCGAATTATCTTTCCTCCATTGATCCTATCAAATTCCGCTCCCGCGCTGTGGATCTAGATAAGACTCATGGACATTTCACTGGGGAAGCTATCACATTCCTCA
CCGAAATCCGACCAGAGGACTTCAACGCCCCTCGCGCACTTTGGCGAAACGTATTTGATGAGCCTGCGAGAGAGAGGTTCATCAACAATGTGACCGGCAAGATGAAGCTGTGTAAGCAGG
AGGAGCCGTTGAAGCGACAGATTGCCATCTTCCGTGAAGTTGATCCTGAGATTGCGGAGAGATTGGAGAAGTCAACCGGTATCAAAGGATACGATGGAATTTCTAACATGGCATTTAATG
GCACGCACAATGGTATGGCTTCTGATGGGAAGAACAAGCTTGCGAATGGAATTGTGGACAAGAATAAAAGTCCTGCTGCACGCCAAGGTGCTCCTGGTTCTGGGGCCCATGGCAGTTTGG
TGACAAACGGAAAGTCGAACGGTGTAAATGGACATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCTTCAGCAACAGACACCTCCTTCGCAGCCCACGTAGCAAGCCAATTCCAATCCTACGAAACAGACCGTCAAGCCTCATCCAAAGAAACCCTCTACACCACCTCCAACGGCGTC
CCCATCGCCCATCCATATGAAACCCAACGAGCCGGTGAAAACGGGCCCCTTCTCCTACAAGACTTCCACCTGATCGATCTCCTCTCACACTTTGACCGCGAGCGTATTCCCGAGCGTGTT
GTTCACGCAAAGGGAAGTGGTGCGCATGGTTATTTTGAGTGTACGGACCCGCTGGATGATTTGTGCCTGGCGGATATCCTGTCGGAGAAGGGGAAGAGATGTTCTGTTAGTATGAGGTTT
TCGACGGTGGGTGGTGAGTCGGGATCGCATGATATGGCGAGAGATCCGAGGGGGTTTTCGGTTAAGATGAGGACTGATGAGGGT
AATTGGGATATGGTCTTCAACAACACGCCTGTCTTC
TTTTTGAGAGACCCGGCCAAGTTCCCTCACTTCATCCACACCCAGAAGCGAGACCCAA
GCACTCATCTCACTCATGCCGACGATTCATTCATGTTCTGGGACTACCTCTCCCAGAACCCC
GAATCAATCCACCAAGTCATGATCCTAATGGGTGACAGGGGGATTCCGAAGAATTACAGACAAATGCATGGTTATAGCGGTCACACCTTCAAGCTTATCAACAAGGCTGGCGAGTGGGTT
TACTGTCAAATTCACCTCAAGTCGATGCAGGGTGTCGACTTTGTCACCCAGGAAGAGTCAGCTGACTACTCCCCTGATCACTCGCAAAAGGATTTGTATGAAGCTATCCAGAATGGAGAT
TATCCTAAATGGACTCTTGAAGTTCAGACTATGACTGCCAAGGAAGCTGAGGAGTTGTGGGAGAAGCAAAAGATCAACGTCTTTGACCTCACGCATGTCTGGCCTCAGAAGCAATTCCCT
CGCCGCAAGGTCGGAGAGTTCACACTCAACGAGAACGCAATCAACTACTTTGCGGAAGTTGAGCAGATTGCTTTCAATCCTTCTCATCTTCCTCCCGGTGTCGAGCCATCGGCCGATCCC
GTTCTTCAATCCCGGTTGTTCTCTTATCCGGATACCCATCGCCATCGTCTCGGTGTAAATTACCAGCAATTGCCTGTCAACGCAACACGCACAGGGTATCAATTCGGTAACTTCCAGCGT
GACGGCCAAATGACATTCTATAACCAGGGTGCACGACCGAATTATCTTTCCTCCATTGATCCTATCAAATTCCGCTCCCGCGCTGTGGATCTAGATAAGACTCATGGACATTTCACTGGG
GAAGCTATCACATTCCTCACCGAAATCCGACCAGAGGACTTCAACGCCCCTCGCGCACTTTGGCGAAACGTATTTGATGAGCCTGCGAGAGAGAGGTTCATCAACAATGTGACCGGCAAG
ATGAAGCTGTGTAAGCAGGAGGAGCCGTTGAAGCGACAGATTGCCATCTTCCGTGAAGTTGATCCTGAGATTGCGGAGAGATTGGAGAAGTCAACCGGTATCAAAGGATACGATGGAATT
TCTAACATGGCATTTAATGGCACGCACAATGGTATGGCTTCTGATGGGAAGAACAAGCTTGCGAATGGAATTGTGGACAAGAATAAAAGTCCTGCTGCACGCCAAGGTGCTCCTGGTTCT
GGGGCCCATGGCAGTTTGGTGACAAACGGAAAGTCGAACGGTGTAAATGGACATTAA

Retrieve as FASTA