Entry information : GzKat03
Entry ID 5227
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2007-04-16 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzKat03
Name GzKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzKat03
start..stop
S start..stop
CpurKat02 1106 0 1..715 1..714
CthedisKat2 1014 0 18..716 22..723
CtheKat2 1010 0 11..716 15..723
CgKat02 1009 0 4..715 6..704
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 993676..993951 276 N° 2 993420..993622 203 N° 3 992764..993367 604 N° 4 992505..992712 208
N° 5 991610..992469 860  
complement(join(991610..992469,992505..992712,992764..993367,993420..993622,9936 76..993951))


exon

Literature and cross-references GzKat03
Literature Birren B, Lander E, Galagan J, Nusbaum C, Devon K et al.
"Genome sequence of Fusarium graminearum (Gibberella zeae)." Unpublished (2007)
Protein ref. UniProtKB_Uniparc:   Q4I7S5
DNA ref. JGI genome:   Supercontig_3.4 (993951..991610)
Cluster/Prediction ref. GenBank:   XM_386909
Protein sequence: GzKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   716 (698)
PWM (Da):   %s   78442.69 (76688.7)  
PI (pH):   %s   6.55 (6.48) Peptide Signal:   %s   cut: 19 range:19-716
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSSKLLVVLGLASLTAAQCPYADPAKLAARDEGSSREHLKDYEVDDSKGHMSSDAGGPFEEQESLKAGERGPTLLEDFIFRQKITHFDHERVPERAVHARGAGAHGYFKSYSDWSNITAASFLSSKDKNTPVFVRFSTVAGSRGSADTVRDVHGFATRFYTDAGLFDIVGNNIPVFFIQDAIQFPDLIHAVKPSPDSEIPQAATAHDSAWDFFSQQTTTLHTLFWAMAGYGIPRSFRHVDGFGVHTFRLVTDEGDTKFVKWHWKSKQGKASLVWDEAQHLAGKNADYHRADLWNAIESGNGPEWELNAQIFDEDQALAFGFDVLDATKIIPEELAPLQPIGVMKLDTNPVNYFAETEQVFQPGHIVRGIDFTEDPLLQGRIFSYLDTQLNRHGGPNFEQLPINRPLSPIHNNNRDGAGQNFIHKNTAASDSLDTPNTLNKGYPVQANQTQGKGFFTAPGRKVSGNLVRARASTFSDHWSQPRLFYNSLTKVEQQFLINAIRFETSQLMSETVQKNVLYQLNKISHDIAVRVGRALGLKAPEADDKYYHDNTTAGISIFGTKLPSIATLSVGVLVSINSNNSIQQAKALKKALGEDKVTVSIIGEVLGDDVEVTYSAATAAQFDSVVVTSGTESLFNGTGKSTLFPPGRPTQIIVDGYHWGKPVGFIGGAKAAAQAARVSKGKGVYFPKNVNSLVEDLKDGLATFKFTDRFPLDH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 5 exons). Strain="PH-1 / NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCTTCTAAGCTTCTTGTTGTTCTTGGACTTGCCAGCCTAACCGCTGCACAATGTCCCTACGCCGACCCGGCCAAACTAGCAGCTAGAGATGAAGGAAGTTCTCGTGAACATCTC
AAGGACTATGAAGTCGATGATAGTAAGGGGCATATGAGTTCCGATGCTGGTGGCCCCTTTGAGGAACAGGAGAGTTTAAAGGCAGGAGAACGAGGCCCTACTCTGCTCGAAGACTTTATC
TTCCGCCAAAAGATCACACATTTCGATCACGAACGG
GTATCTACTCTCTGAGATATCAATTCTATGTTGTGGAATTAACATCTTTGCAGGTCCCTGAAAGAGCCGTCCACGCCCGAGGTG
CTGGGGCTCATGGTTACTTCAAGAGCTACAGTGACTGGAGCAACATCACAGCAGCTTCTTTCCTCAGCTCAAAAGACAAAAATACTCCCGTCTTTGTGCGCTTTTCGACCGTTGCTGGTT
CTAGAGGTAGCGCCGATACTGTGCGAGATGTGCACGGATTCGCTACCCGATT
GTACGATCCAACCCAGGCTCACGAGAAAGCAATAACTTACATATTTATACAGCTACACAGATGCTGGC
TTATTTGACATTGTGGGCAACAATATCCCTGTATTCTTTATTCAAGATGCAATTCAGTTCCCAGACCTCATCCACGCTGTTAAGCCATCCCCTGACAGTGAGATCCCGCAAGCCGCCACA
GCTCACGACTCAGCATGGGACTTTTTCAGTCAGCAAACTACAACCCTACACACTCTATTCTGGGCCATGGCAGGATATGGAATTCCACGTTCGTTTCGTCACGTAGATGGGTTCGGTGTT
CACACTTTCCGTCTAGTGACTGATGAGGGTGACACCAAGTTCGTCAAGTGGCACTGGAAGAGCAAGCAGGGCAAAGCGAGCCTAGTATGGGACGAAGCACAGCACCTGGCCGGAAAGAAC
GCCGATTATCATCGTGCTGATCTCTGGAATGCCATTGAGTCTGGTAACGGGCCTGAATGGGAACTCAATGCCCAGATCTTTGACGAGGACCAGGCTCTGGCGTTTGGATTTGATGTTCTG
GACGCTACCAAAATCATTCCTGAAGAGCTAGCTCCTCTCCAGCCTATTGGTGTTATGAAGTTGGACACAAACCCCGTCAACTATTTCGCTGAGACTGAGCAGGTCATG
GTGAGTAAACAT
GTCGAACAAACCACCCAATAATTTTGCTAACCCAGATAGTTCCAACCTGGCCACATTGTTCGCGGTATCGACTTTACCGAAGATCCTCTGCTGCAGGGACGTATCTTTTCTTACCTTGAT
ACCCAACTCAACCGTCACGGTGGTCCCAACTTTGAGCAACTCCCCATCAACCGTCCTCTGTCTCCTATCCATAACAACAACCGTGATGGAGCCGGGCAGAACTTTATCCACAAGAATACT
GCTGCTT
GTGAGTTAACTTCCAATAAATCCTGGACCATCTAGCTGACTCTCTAGACACCCCTAATACTCTAAACAAGGGCTACCCTGTTCAGGCAAACCAGACACAAGGAAAAGGCTTCT
TTACTGCCCCTGGCCGCAAGGTTTCTGGAAACCTGGTGCGCGCCAGAGCATCCACCTTCTCTGACCACTGGAGCCAGCCACGACTCTTCTACAACTCTCTGACCAAAGTAGAGCAGCAGT
TTCTCATCAACGCCATACGTTTCGAGACAAGTCAGCTCATGTCTGAAACTGTCCAGAAGAACGTTCTCTACCAGCTGAACAAAATCAGCCACGATATTGCTGTCAGAGTTGGCAGGGCTT
TGGGTCTCAAAGCTCCTGAGGCTGACGACAAGTACTACCACGACAATACCACAGCCGGAATCTCCATTTTTGGAACCAAGTTGCCAAGCATTGCAACGCTCTCTGTTGGTGTCTTGGTTT
CTATCAACTCTAATAACTCCATCCAACAAGCCAAGGCTCTCAAGAAGGCACTTGGCGAGGACAAGGTGACCGTGTCGATTATAGGCGAAGTTCTTGGAGACGATGTTGAAGTTACTTACA
GTGCTGCAACTGCCGCTCAATTTGATAGTGTCGTTGTTACCAGCGGTACTGAGTCTCTTTTCAACGGCACCGGAAAGTCAACTCTATTCCCTCCTGGCCGTCCTACGCAGATTATTGTGG
ACGGTTATCATTGGGGCAAGCCTGTTGGATTTATTGGAGGTGCAAAGGCGGCAGCTCAGGCTGCGAGAGTTAGTAAAGGAAAAGGAGTGTACTTTCCGAAGAACGTTAACTCTTTGGTTG
AAGATTTAAAGGATGGGTTGGCTACTTTCAAGTTCACTGACCGATTCCCCCTGGACCACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCTTCTAAGCTTCTTGTTGTTCTTGGACTTGCCAGCCTAACCGCTGCACAATGTCCCTACGCCGACCCGGCCAAACTAGCAGCTAGAGATGAAGGAAGTTCTCGTGAACATCTC
AAGGACTATGAAGTCGATGATAGTAAGGGGCATATGAGTTCCGATGCTGGTGGCCCCTTTGAGGAACAGGAGAGTTTAAAGGCAGGAGAACGAGGCCCTACTCTGCTCGAAGACTTTATC
TTCCGCCAAAAGATCACACATTTCGATCACGAACGG
GTCCCTGAAAGAGCCGTCCACGCCCGAGGTGCTGGGGCTCATGGTTACTTCAAGAGCTACAGTGACTGGAGCAACATCACAGCA
GCTTCTTTCCTCAGCTCAAAAGACAAAAATACTCCCGTCTTTGTGCGCTTTTCGACCGTTGCTGGTTCTAGAGGTAGCGCCGATACTGTGCGAGATGTGCACGGATTCGCTACCCGATT
C
TACACAGATGCTGGCTTATTTGACATTGTGGGCAACAATATCCCTGTATTCTTTATTCAAGATGCAATTCAGTTCCCAGACCTCATCCACGCTGTTAAGCCATCCCCTGACAGTGAGATC
CCGCAAGCCGCCACAGCTCACGACTCAGCATGGGACTTTTTCAGTCAGCAAACTACAACCCTACACACTCTATTCTGGGCCATGGCAGGATATGGAATTCCACGTTCGTTTCGTCACGTA
GATGGGTTCGGTGTTCACACTTTCCGTCTAGTGACTGATGAGGGTGACACCAAGTTCGTCAAGTGGCACTGGAAGAGCAAGCAGGGCAAAGCGAGCCTAGTATGGGACGAAGCACAGCAC
CTGGCCGGAAAGAACGCCGATTATCATCGTGCTGATCTCTGGAATGCCATTGAGTCTGGTAACGGGCCTGAATGGGAACTCAATGCCCAGATCTTTGACGAGGACCAGGCTCTGGCGTTT
GGATTTGATGTTCTGGACGCTACCAAAATCATTCCTGAAGAGCTAGCTCCTCTCCAGCCTATTGGTGTTATGAAGTTGGACACAAACCCCGTCAACTATTTCGCTGAGACTGAGCAGGTC
ATG
TTCCAACCTGGCCACATTGTTCGCGGTATCGACTTTACCGAAGATCCTCTGCTGCAGGGACGTATCTTTTCTTACCTTGATACCCAACTCAACCGTCACGGTGGTCCCAACTTTGAG
CAACTCCCCATCAACCGTCCTCTGTCTCCTATCCATAACAACAACCGTGATGGAGCCGGGCAGAACTTTATCCACAAGAATACTGCTGCTT
CTGACTCTCTAGACACCCCTAATACTCTA
AACAAGGGCTACCCTGTTCAGGCAAACCAGACACAAGGAAAAGGCTTCTTTACTGCCCCTGGCCGCAAGGTTTCTGGAAACCTGGTGCGCGCCAGAGCATCCACCTTCTCTGACCACTGG
AGCCAGCCACGACTCTTCTACAACTCTCTGACCAAAGTAGAGCAGCAGTTTCTCATCAACGCCATACGTTTCGAGACAAGTCAGCTCATGTCTGAAACTGTCCAGAAGAACGTTCTCTAC
CAGCTGAACAAAATCAGCCACGATATTGCTGTCAGAGTTGGCAGGGCTTTGGGTCTCAAAGCTCCTGAGGCTGACGACAAGTACTACCACGACAATACCACAGCCGGAATCTCCATTTTT
GGAACCAAGTTGCCAAGCATTGCAACGCTCTCTGTTGGTGTCTTGGTTTCTATCAACTCTAATAACTCCATCCAACAAGCCAAGGCTCTCAAGAAGGCACTTGGCGAGGACAAGGTGACC
GTGTCGATTATAGGCGAAGTTCTTGGAGACGATGTTGAAGTTACTTACAGTGCTGCAACTGCCGCTCAATTTGATAGTGTCGTTGTTACCAGCGGTACTGAGTCTCTTTTCAACGGCACC
GGAAAGTCAACTCTATTCCCTCCTGGCCGTCCTACGCAGATTATTGTGGACGGTTATCATTGGGGCAAGCCTGTTGGATTTATTGGAGGTGCAAAGGCGGCAGCTCAGGCTGCGAGAGTT
AGTAAAGGAAAAGGAGTGTACTTTCCGAAGAACGTTAACTCTTTGGTTGAAGATTTAAAGGATGGGTTGGCTACTTTCAAGTTCACTGACCGATTCCCCCTGGACCACTAA

Retrieve as FASTA