Entry information : FoCP02-1 (FoHPI / FoCP02-1)
Entry ID 5228
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2011-05-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoCP02-1 (FoHPI / FoCP02-1)
Name (synonym) FoCP02-1 (FoHPI / FoCP02-1)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoCP02-1
start..stop
S start..stop
FoCP03 1555 0 1..781 1..781
FoCP04 1505 0 1..777 1..777
GmoCP02 1499 0 1..777 1..777
GzCP02 1325 0 21..777 20..777
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 219912..220197 286 N° 2 219705..219859 155 N° 3 219579..219651 73 N° 4 219099..219530 432
N° 5 218910..219045 136 N° 6 217597..218860 1264  
complement(join(217597..218860,218910..219045,219099..219530,219579..219651,2197 05..219859,219912..220197))


exon

Literature and cross-references FoCP02-1 (FoHPI / FoCP02-1)
Literature Broad Institute genome project, unpublished
DNA ref. JGI genome:   Supercontig_2.42 (220197..217597)
Protein sequence: FoCP02-1 (FoHPI / FoCP02-1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   781 (763)
PWM (Da):   %s   85632.22 (83782.2)  
PI (pH):   %s   6.81 (6.76) Peptide Signal:   %s   cut: 19 range:19-781
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVQSLLLASGLVPFVASQGCPFAKRATDNNLVPPREIPEDFGICRVASNQAGGGTRSRGFWPCALRLDVLRQFSPQYNPLGADFDYAEAFKSLDYESLKRDLKALLTDSQDWWPADHGSYGGLFIRMSWHSAGTYRAMDGRGGAGGQQRFAPLDSWPDNQNLDKARRLLWPIKQKYGSKISWADMIVLAGNVALEHSGFETLGFAGGRADTWEADESIYWGAESTFVPKGNDVRYNGSTDIYERADKLEKPLGATHFGLIYVNPEGPDGSSDPKASALDIRTAFGRMGMDDEETAALIIGGHTLGKTHGAVSSKNIGPEPMAADLGEMGLGWHNSVNEGNGPDQMTSGLEVIWSTTPTKWSNHFLKSLLGNNWTLVESPAGHKQWEALDGKLEYPDPFVKGKFRRPTMLTSDLALINDPSYLKICKRWHDHPKEMNQAFARAWYKLLHRDLGPVSRYLGPEVPKEKFIWQDPLPERKGDIISEGDISSLKSAILSTDGLTVSKLVSTAWNSASTFRGTDKRGGANGARIALEPQVSWASNNPKQLKQVLSALKKIQKDFNSKSGPNQVSLADLIVLGGVAAVEKAAQDAGFKGVEVPFTPGRVDATQNQTDLVQFGYLEPLADGFRNYGHGTARARTEEILVDRAALLTLTPPEMTVLVGGLRALNANFDGSSNGILTEKKGQLTNDFFVNLLSPAYSWSKKDDRGELWTGTDRATKSAKWTATRADLVFGSHAELRAISEVYGSTDAKEKFVRDFISAWTKVMNLDRFDVKSEKEAKY

Retrieve as FASTA  
Remarks Complete from genomic (Chromo 6, 5 introns). No EST available. Strain="4286".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTTCAATCACTTCTGTTGGCTTCTGGCCTCGTGCCTTTCGTCGCTAGCCAGGGCTGCCCTTTCGCCAAGCGCGCCACAGACAATAACCTTGTCCCCCCGCGAGAAATACCCGAA
GATTTTGGCATCTGCCGCGTCGCTAGCAATCAGGCTGGTGGAGGTACCCGAAGCAGAGGCTTTTGGCCTTGTGCTTTGAGATTAGATGTTCTTCGACAATTTTCGCCTCAGTATAACCCA
TTGGGTGCGGATTTTGACTACGCTGAGGCGTTCAAGTCTCTGGACT
GTGAGTTTCACTCATCTTGGGGTTGAAACGGGTTTTCTGATTGATTGCGTAGATGAGAGCTTGAAGAGGGATCT
CAAAGCGCTTCTTACCGATTCTCAGGATTGGTGGCCTGCTGACCATGGTAGCTATGGTGGTCTCTTCATCCGTATGTCATGGCACAGCGCTGGTACTTACCGTGCCATGGATGGCCGAGG
TGGCGCTGGAATG
GTGAGTGCAGAATCTGACTGAGATATTATTGAATCATTCGCTGACATTTGCAGGGCCAACAACGATTTGCTCCTCTCGATAGCTGGCCCGACAACCAGAACCTGGAC
AAGGCTCGCCGTCTGCTCT
GTACGTTTCACAACAGCCATGCAAACAACCAATTCTGACAAATCACAGGGCCTATTAAGCAAAAGTACGGCAGCAAGATTTCATGGGCTGACATGATCGTT
CTCGCCGGCAACGTCGCCCTCGAACACAGTGGTTTCGAGACCCTCGGTTTCGCTGGTGGCCGAGCCGACACCTGGGAGGCCGATGAGTCTATCTACTGGGGTGCCGAGTCTACCTTTGTT
CCCAAGGGTAACGATGTTCGCTACAACGGTAGCACTGACATTTATGAGCGAGCTGATAAGCTTGAGAAGCCTCTTGGTGCTACTCACTTCGGTCTCATTTATGTTAACCCCGAGGGTCCT
GATGGAAGCTCTGACCCTAAGGCTTCTGCTCTTGATATTCGTACTGCTTTTGGCCGTATGGGTATGGATGATGAGGAGACTGCTGCTCTCATCATTGGTGGCCACACCCTGGGCAAGACT
CACGGTGCTGTTTCTTCTA
GTAAGTGTCTCATCTGTCGAACAGGTTTGAGGCAATACTGATTGTGGTTTCAGAGAACATTGGCCCTGAGCCTATGGCTGCTGACCTTGGAGAGATGGGTC
TCGGCTGGCACAACAGCGTCAACGAGGGTAATGGCCCTGACCAGATGACCAGTGGCCTTGAGGTTATCTGGTCTACGACTCCCACCAA
GTACGTCCTCTCCCTCTCATTGACCCTCCCTC
CAACTAATAGTTCTCAGGTGGAGCAACCACTTCCTCAAGAGTCTTCTCGGCAACAACTGGACTCTGGTCGAGAGTCCCGCAGGCCACAAGCAATGGGAAGCCCTCGACGGCAAACTCGAA
TACCCAGACCCCTTCGTCAAGGGCAAGTTCCGCAGACCCACTATGCTCACCAGCGATCTCGCCCTCATTAATGACCCTTCCTACCTCAAGATCTGCAAGCGCTGGCACGACCACCCCAAG
GAGATGAACCAGGCTTTCGCTCGTGCTTGGTACAAGCTTCTCCACCGTGATCTCGGCCCTGTTTCTCGTTACCTTGGACCTGAGGTTCCTAAGGAGAAATTTATCTGGCAGGATCCTCTC
CCTGAGCGAAAGGGAGACATCATCAGCGAGGGTGACATCTCTAGCCTCAAGTCTGCTATTCTTTCTACTGATGGTCTTACTGTTTCCAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCT
ACTTTCCGTGGGACTGACAAGCGTGGTGGTGCCAACGGTGCTCGCATTGCTCTTGAGCCTCAGGTCAGCTGGGCCAGCAACAACCCCAAGCAGCTGAAGCAGGTCCTCTCCGCCCTGAAG
AAGATCCAGAAGGATTTCAACTCCAAGTCCGGCCCTAATCAGGTCTCTCTCGCTGACCTGATCGTTCTCGGCGGTGTTGCCGCTGTTGAGAAGGCTGCCCAGGATGCTGGCTTCAAGGGC
GTTGAGGTTCCCTTCACTCCTGGTCGTGTTGATGCTACCCAGAACCAGACCGATCTTGTTCAGTTCGGTTACCTTGAGCCTCTTGCTGACGGGTTCCGTAACTACGGTCATGGCACTGCT
CGTGCTCGCACCGAGGAGATTCTCGTTGACCGCGCTGCTCTTCTTACCCTTACTCCTCCCGAGATGACCGTCCTTGTCGGTGGTCTCCGTGCCTTGAACGCCAACTTCGACGGCTCATCC
AACGGTATCCTCACCGAGAAGAAGGGCCAACTCACCAACGACTTCTTCGTCAACCTTCTCTCTCCCGCCTACTCATGGAGCAAGAAGGACGACCGTGGTGAGCTCTGGACTGGTACTGAC
CGTGCCACCAAGTCCGCCAAGTGGACTGCTACCCGCGCTGATCTTGTCTTCGGATCTCACGCTGAGCTGCGTGCTATTTCTGAGGTTTATGGTAGCACTGATGCGAAGGAGAAGTTTGTG
AGGGATTTCATTTCAGCGTGGACCAAGGTTATGAACCTGGACCGCTTTGATGTCAAGTCTGAGAAGGAGGCCAAGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTTCAATCACTTCTGTTGGCTTCTGGCCTCGTGCCTTTCGTCGCTAGCCAGGGCTGCCCTTTCGCCAAGCGCGCCACAGACAATAACCTTGTCCCCCCGCGAGAAATACCCGAA
GATTTTGGCATCTGCCGCGTCGCTAGCAATCAGGCTGGTGGAGGTACCCGAAGCAGAGGCTTTTGGCCTTGTGCTTTGAGATTAGATGTTCTTCGACAATTTTCGCCTCAGTATAACCCA
TTGGGTGCGGATTTTGACTACGCTGAGGCGTTCAAGTCTCTGGACT
ATGAGAGCTTGAAGAGGGATCTCAAAGCGCTTCTTACCGATTCTCAGGATTGGTGGCCTGCTGACCATGGTAGC
TATGGTGGTCTCTTCATCCGTATGTCATGGCACAGCGCTGGTACTTACCGTGCCATGGATGGCCGAGGTGGCGCTGGAATG
GGCCAACAACGATTTGCTCCTCTCGATAGCTGGCCCGAC
AACCAGAACCTGGACAAGGCTCGCCGTCTGCTCT
GGCCTATTAAGCAAAAGTACGGCAGCAAGATTTCATGGGCTGACATGATCGTTCTCGCCGGCAACGTCGCCCTCGAACACAGTGGT
TTCGAGACCCTCGGTTTCGCTGGTGGCCGAGCCGACACCTGGGAGGCCGATGAGTCTATCTACTGGGGTGCCGAGTCTACCTTTGTTCCCAAGGGTAACGATGTTCGCTACAACGGTAGC
ACTGACATTTATGAGCGAGCTGATAAGCTTGAGAAGCCTCTTGGTGCTACTCACTTCGGTCTCATTTATGTTAACCCCGAGGGTCCTGATGGAAGCTCTGACCCTAAGGCTTCTGCTCTT
GATATTCGTACTGCTTTTGGCCGTATGGGTATGGATGATGAGGAGACTGCTGCTCTCATCATTGGTGGCCACACCCTGGGCAAGACTCACGGTGCTGTTTCTTCTA
AGAACATTGGCCCT
GAGCCTATGGCTGCTGACCTTGGAGAGATGGGTCTCGGCTGGCACAACAGCGTCAACGAGGGTAATGGCCCTGACCAGATGACCAGTGGCCTTGAGGTTATCTGGTCTACGACTCCCACC
AA
GTGGAGCAACCACTTCCTCAAGAGTCTTCTCGGCAACAACTGGACTCTGGTCGAGAGTCCCGCAGGCCACAAGCAATGGGAAGCCCTCGACGGCAAACTCGAATACCCAGACCCCTTC
GTCAAGGGCAAGTTCCGCAGACCCACTATGCTCACCAGCGATCTCGCCCTCATTAATGACCCTTCCTACCTCAAGATCTGCAAGCGCTGGCACGACCACCCCAAGGAGATGAACCAGGCT
TTCGCTCGTGCTTGGTACAAGCTTCTCCACCGTGATCTCGGCCCTGTTTCTCGTTACCTTGGACCTGAGGTTCCTAAGGAGAAATTTATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGA
GACATCATCAGCGAGGGTGACATCTCTAGCCTCAAGTCTGCTATTCTTTCTACTGATGGTCTTACTGTTTCCAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGGACT
GACAAGCGTGGTGGTGCCAACGGTGCTCGCATTGCTCTTGAGCCTCAGGTCAGCTGGGCCAGCAACAACCCCAAGCAGCTGAAGCAGGTCCTCTCCGCCCTGAAGAAGATCCAGAAGGAT
TTCAACTCCAAGTCCGGCCCTAATCAGGTCTCTCTCGCTGACCTGATCGTTCTCGGCGGTGTTGCCGCTGTTGAGAAGGCTGCCCAGGATGCTGGCTTCAAGGGCGTTGAGGTTCCCTTC
ACTCCTGGTCGTGTTGATGCTACCCAGAACCAGACCGATCTTGTTCAGTTCGGTTACCTTGAGCCTCTTGCTGACGGGTTCCGTAACTACGGTCATGGCACTGCTCGTGCTCGCACCGAG
GAGATTCTCGTTGACCGCGCTGCTCTTCTTACCCTTACTCCTCCCGAGATGACCGTCCTTGTCGGTGGTCTCCGTGCCTTGAACGCCAACTTCGACGGCTCATCCAACGGTATCCTCACC
GAGAAGAAGGGCCAACTCACCAACGACTTCTTCGTCAACCTTCTCTCTCCCGCCTACTCATGGAGCAAGAAGGACGACCGTGGTGAGCTCTGGACTGGTACTGACCGTGCCACCAAGTCC
GCCAAGTGGACTGCTACCCGCGCTGATCTTGTCTTCGGATCTCACGCTGAGCTGCGTGCTATTTCTGAGGTTTATGGTAGCACTGATGCGAAGGAGAAGTTTGTGAGGGATTTCATTTCA
GCGTGGACCAAGGTTATGAACCTGGACCGCTTTGATGTCAAGTCTGAGAAGGAGGCCAAGTACTAG

Retrieve as FASTA