Entry information : FoCP04
Entry ID 5229
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2011-05-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoCP04
Name FoCP04
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoCP04
start..stop
S start..stop
GmoCP02 1543 0 1..777 1..777
FoCP03 1529 0 1..777 1..777
FoCP02-1 1523 0 1..777 1..777
GzCP02 1336 0 21..777 20..777
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 151194..151479 286 N° 2 151532..151686 155 N° 3 151739..151811 73 N° 4 151861..152428 568
N° 5 152479..153730 1252  
join(151194..151479,151532..151686,151739..151811,151861..152428,152479..153730)


exon

Literature and cross-references FoCP04
Literature Broad Institute genome project, unpublished
DNA ref. JGI genome:   Supercontig_2.46 (151194..153730)
EST ref. GenBank:   BW644617 [Fragment]
Cluster/Prediction ref. JGI gene:   13792
Protein sequence: FoCP04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   777 (759)
PWM (Da):   %s   84908.03 (83120.0)  
PI (pH):   %s   7.05 (7.01) Peptide Signal:   %s   cut: 19 range:19-777
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVQSLLLASGLVPLAASQGCPFAKRATDTNLVPPREIPEDFGICRVASNQAGGGTRSRDFWPCALRLDVLRQFSPQYNPLGADFDYTEAFKSLDFAALKKDLNALLTDSQDWWPADHGNYGGLFIRMSWHSAGTYRAMDGRGGSGGQQRFAPLDSWPDNQNLDKARRLLWPIKQKYGSKISWADLMVLAGNVALEHSGFETLGFAGGRADTWEADESIYWGAESTFVPKGNDVRYNGSTDIYERADKLEKPLGATHFGLIYVNPEGPDGSSDPKASALDIRTAFGRMGMDDEETAALIIGGHTLGKTHGAVPAKNIGPEPMAADLGEMGLGWHNSVNEGNGPDQMTSGLEVIWSTTPTKWSNHFLKSLLGNNWTLVESPAGHKQWEALNGKLEYPDPFVKGKFRRPTMLTSDLALINDPSYLKICKRWHDNPKELNAAFARAWYKLLHRDLGPVSRYLGPEVAKEKFIWQDPLPERKGDIIGEADISSLKSAILSADGLDVSKLVSTAWNSASTFRGTDKRGGANGARIALEPQVNWVSNNPKQLKQVLSALKKVQKDFNSKSGSKKVSLADLIVLGGVAAIEKAAQAAGFKDVEVPFTPGRVDATQNQTDLVQFGYLEPLADGFRNYGHGTARARTEEILVDRAALLTLTPPEMTVLVGGLRALNANYDGSSNGILTEKKGQLTNDFFVNLLSPAYSWAKKDSQGEIWTGTDRATKSVKWTATRADLVFGSHAELRAISEVYGSADAKEKFVKDFISAWTKVMNLDRFDVKAEK

Retrieve as FASTA  
Remarks Complete from genomic (4 introns) and 1 EST. Strain="4286".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGTACAATCACTTCTGCTGGCTTCTGGCCTCGTGCCTCTGGCCGCTAGCCAGGGCTGCCCCTTTGCCAAGCGCGCCACAGACACTAATCTTGTTCCCCCGAGAGAAATCCCCGAG
GACTTTGGCATCTGCCGCGTCGCTAGCAACCAGGCTGGTGGCGGTACCCGATCCAGGGACTTTTGGCCTTGTGCTTTGAGACTGGATGTCTTGAGGCAGTTTTCGCCTCAGTATAACCCA
TTGGGTGCTGATTTCGACTACACTGAGGCTTTCAAGTCTCTGGACT
GTAAGTTTCACTCATCCTGGGATTGAAGGATTTTTGCTTACTTTTTTGGTAGTTGCTGCTTTGAAGAAGGATCT
CAATGCACTTCTCACTGATTCTCAGGATTGGTGGCCTGCTGACCATGGTAACTATGGCGGTCTCTTCATCCGCATGTCATGGCACAGCGCTGGTACCTACCGCGCAATGGACGGCCGAGG
TGGCTCCGGAATG
GTGAGCCATGAACTCAATGCCATATTCTCGAGTGTTTTGCTGATATCCACAGGGTCAACAACGATTTGCTCCTCTCGACAGCTGGCCCGACAACCAGAACCTGGACA
AGGCTCGCCGTCTGCTCT
GTACGTTACACAGCCGTCACACAAACCCCCAAAGTCTAACAAATCACAGGGCCTATCAAGCAAAAGTATGGCAGCAAGATCTCATGGGCTGACTTGATGGTC
CTCGCCGGCAACGTCGCCCTCGAGCACAGCGGCTTCGAGACCCTTGGTTTCGCCGGTGGTCGCGCTGACACCTGGGAGGCCGATGAGTCCATCTACTGGGGTGCCGAGTCCACCTTTGTC
CCCAAGGGTAACGACGTTCGCTACAACGGTAGCACAGACATTTACGAGCGTGCCGATAAGCTCGAGAAGCCTCTTGGTGCTACGCACTTTGGTCTCATTTATGTTAACCCCGAGGGTCCT
GATGGAAGCTCTGATCCTAAGGCTTCTGCTCTTGATATCCGTACTGCTTTTGGCCGTATGGGTATGGACGATGAGGAGACTGCTGCTCTCATCATTGGTGGTCACACCCTGGGCAAAACT
CATGGTGCTGTTCCTGCTAAGAACATTGGCCCTGAGCCCATGGCTGCTGACCTTGGAGAGATGGGTCTTGGCTGGCACAACAGCGTCAACGAGGGTAACGGTCCTGACCAGATGACCAGT
GGTCTTGAGGTTATCTGGTCCACCACTCCCACCAA
GTACGTTCCTCTCCCTACATTCTACTCTCACTCTTACTAACAAGTCCCAGGTGGAGCAACCACTTCCTCAAGTCTCTTCTCGGCA
ACAACTGGACCCTCGTCGAGAGCCCCGCAGGCCACAAGCAATGGGAAGCTCTCAACGGCAAGCTCGAGTACCCCGACCCCTTCGTCAAGGGCAAGTTCCGCCGCCCCACCATGCTCACCA
GCGATCTCGCCCTCATCAACGACCCCTCGTACCTCAAGATCTGCAAGCGCTGGCACGACAACCCCAAGGAGTTGAACGCTGCTTTCGCCCGCGCCTGGTACAAGCTCCTCCACCGTGATC
TCGGTCCTGTCTCTCGCTACCTTGGCCCCGAGGTCGCTAAGGAGAAGTTCATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGCGACATCATTGGCGAGGCTGATATTTCTAGCCTCAAGT
CTGCTATCCTCTCTGCTGATGGTCTTGATGTTTCTAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGAACTGACAAGCGTGGTGGTGCCAACGGTGCCCGTATTGCTC
TTGAGCCTCAGGTCAACTGGGTCAGCAACAACCCCAAGCAGCTCAAGCAGGTCCTCTCTGCCCTGAAGAAGGTCCAGAAGGACTTCAATTCCAAGTCCGGCTCCAAGAAGGTTTCTCTCG
CTGATCTGATTGTCCTCGGTGGTGTTGCTGCTATTGAGAAGGCTGCCCAGGCTGCTGGCTTCAAGGACGTCGAGGTTCCCTTCACTCCTGGCCGTGTTGACGCTACTCAGAACCAGACTG
ATCTCGTTCAGTTCGGTTACCTTGAGCCTCTTGCTGATGGTTTCCGCAACTACGGACATGGAACTGCCCGTGCTCGCACTGAGGAGATCCTTGTCGACCGCGCTGCTCTTCTTACCCTTA
CTCCTCCCGAGATGACTGTCCTTGTCGGTGGTCTCCGTGCCTTGAACGCCAACTACGACGGTTCATCCAACGGTATTCTCACCGAGAAGAAGGGCCAACTCACCAACGACTTCTTCGTCA
ACCTTCTCTCCCCAGCCTACTCATGGGCCAAGAAGGACAGCCAGGGTGAGATCTGGACTGGTACTGACCGTGCCACCAAGTCTGTCAAGTGGACTGCTACCCGCGCTGATCTTGTCTTCG
GATCTCACGCTGAGCTGCGTGCTATTTCTGAGGTCTACGGTAGTGCTGATGCGAAGGAGAAGTTTGTGAAGGATTTCATTTCTGCGTGGACCAAGGTCATGAACCTGGACCGCTTTGATG
TCAAGGCTGAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGTACAATCACTTCTGCTGGCTTCTGGCCTCGTGCCTCTGGCCGCTAGCCAGGGCTGCCCCTTTGCCAAGCGCGCCACAGACACTAATCTTGTTCCCCCGAGAGAAATCCCCGAG
GACTTTGGCATCTGCCGCGTCGCTAGCAACCAGGCTGGTGGCGGTACCCGATCCAGGGACTTTTGGCCTTGTGCTTTGAGACTGGATGTCTTGAGGCAGTTTTCGCCTCAGTATAACCCA
TTGGGTGCTGATTTCGACTACACTGAGGCTTTCAAGTCTCTGGACT
TTGCTGCTTTGAAGAAGGATCTCAATGCACTTCTCACTGATTCTCAGGATTGGTGGCCTGCTGACCATGGTAAC
TATGGCGGTCTCTTCATCCGCATGTCATGGCACAGCGCTGGTACCTACCGCGCAATGGACGGCCGAGGTGGCTCCGGAATG
GGTCAACAACGATTTGCTCCTCTCGACAGCTGGCCCGAC
AACCAGAACCTGGACAAGGCTCGCCGTCTGCTCT
GGCCTATCAAGCAAAAGTATGGCAGCAAGATCTCATGGGCTGACTTGATGGTCCTCGCCGGCAACGTCGCCCTCGAGCACAGCGGC
TTCGAGACCCTTGGTTTCGCCGGTGGTCGCGCTGACACCTGGGAGGCCGATGAGTCCATCTACTGGGGTGCCGAGTCCACCTTTGTCCCCAAGGGTAACGACGTTCGCTACAACGGTAGC
ACAGACATTTACGAGCGTGCCGATAAGCTCGAGAAGCCTCTTGGTGCTACGCACTTTGGTCTCATTTATGTTAACCCCGAGGGTCCTGATGGAAGCTCTGATCCTAAGGCTTCTGCTCTT
GATATCCGTACTGCTTTTGGCCGTATGGGTATGGACGATGAGGAGACTGCTGCTCTCATCATTGGTGGTCACACCCTGGGCAAAACTCATGGTGCTGTTCCTGCTAAGAACATTGGCCCT
GAGCCCATGGCTGCTGACCTTGGAGAGATGGGTCTTGGCTGGCACAACAGCGTCAACGAGGGTAACGGTCCTGACCAGATGACCAGTGGTCTTGAGGTTATCTGGTCCACCACTCCCACC
AA
GTGGAGCAACCACTTCCTCAAGTCTCTTCTCGGCAACAACTGGACCCTCGTCGAGAGCCCCGCAGGCCACAAGCAATGGGAAGCTCTCAACGGCAAGCTCGAGTACCCCGACCCCTTC
GTCAAGGGCAAGTTCCGCCGCCCCACCATGCTCACCAGCGATCTCGCCCTCATCAACGACCCCTCGTACCTCAAGATCTGCAAGCGCTGGCACGACAACCCCAAGGAGTTGAACGCTGCT
TTCGCCCGCGCCTGGTACAAGCTCCTCCACCGTGATCTCGGTCCTGTCTCTCGCTACCTTGGCCCCGAGGTCGCTAAGGAGAAGTTCATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGC
GACATCATTGGCGAGGCTGATATTTCTAGCCTCAAGTCTGCTATCCTCTCTGCTGATGGTCTTGATGTTTCTAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGAACT
GACAAGCGTGGTGGTGCCAACGGTGCCCGTATTGCTCTTGAGCCTCAGGTCAACTGGGTCAGCAACAACCCCAAGCAGCTCAAGCAGGTCCTCTCTGCCCTGAAGAAGGTCCAGAAGGAC
TTCAATTCCAAGTCCGGCTCCAAGAAGGTTTCTCTCGCTGATCTGATTGTCCTCGGTGGTGTTGCTGCTATTGAGAAGGCTGCCCAGGCTGCTGGCTTCAAGGACGTCGAGGTTCCCTTC
ACTCCTGGCCGTGTTGACGCTACTCAGAACCAGACTGATCTCGTTCAGTTCGGTTACCTTGAGCCTCTTGCTGATGGTTTCCGCAACTACGGACATGGAACTGCCCGTGCTCGCACTGAG
GAGATCCTTGTCGACCGCGCTGCTCTTCTTACCCTTACTCCTCCCGAGATGACTGTCCTTGTCGGTGGTCTCCGTGCCTTGAACGCCAACTACGACGGTTCATCCAACGGTATTCTCACC
GAGAAGAAGGGCCAACTCACCAACGACTTCTTCGTCAACCTTCTCTCCCCAGCCTACTCATGGGCCAAGAAGGACAGCCAGGGTGAGATCTGGACTGGTACTGACCGTGCCACCAAGTCT
GTCAAGTGGACTGCTACCCGCGCTGATCTTGTCTTCGGATCTCACGCTGAGCTGCGTGCTATTTCTGAGGTCTACGGTAGTGCTGATGCGAAGGAGAAGTTTGTGAAGGATTTCATTTCT
GCGTGGACCAAGGTCATGAACCTGGACCGCTTTGATGTCAAGGCTGAGAAGTAG

Retrieve as FASTA