Entry information : GmPrx34 (Glyma12g15460.1) )
Entry ID 523
Creation 2009-01-05 (Christophe Dunand)
Last sequence changes 2011-10-10 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx34 (Glyma12g15460.1) )
Name (synonym) GmPrx34 (Glyma12g15460.1) )
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue types Cotyledons
Etiolated seedlings
Germinating seeds
Hypocotyls
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx34
start..stop
S start..stop
GmPrx89 604 0 1..319 1..319
MtPrx57 515 0 8..319 6..317
PsPrx11 514 0 8..319 6..318
MtPrx28 510 0 7..319 5..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14319638..14319853 216 N° 2 14320419..14320610 192 N° 3 14322278..14322829 552  
join(14319638..14319853,14320419..14320610,14322278..14322829)


exon

Literature and cross-references GmPrx34 (Glyma12g15460.1) )
Literature Public Soybean EST Project.
DNA ref. Phytozome 12:   Gm12 (14319638..14322829)
Cluster/Prediction ref. UniGene:   Gma.31580
Protein sequence: GmPrx34 (Glyma12g15460.1) )
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33826.93 (31184.5)  
PI (pH):   %s   8.4 (8.40) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSLNNHLFVVVSILSLLAFSSNAQLSPTFYAKTCPNLQTIVRSAMRQAVAKEARIGASILRLFFHDCFVNGCDGSILLDDTATFTGEKNAGPNRNSARGFEVIDTIKTNVEASCNATVSCADILALATRDGVVLLGGPSWSVPLGRRDARTASQSAANSQIPGPSSDLSTLTSMFAAKGLTSSDLTVLSGGHTIGQAQCQFFRNRIYNETNIDTNFATTRKANCPATGGNTNLAPLDTLTPNRFDNNYFSDLVNGRGLLHSDQVLFNGGSQDALVRTYSGNNAAFFRDFAAAMVKLGNISPLTGSSGEIRRNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 16 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATTCCCTTAATAACCACCTGTTTGTTGTAGTATCTATTCTTTCTCTCTTAGCCTTTTCTAGCAACGCACAACTATCTCCCACCTTCTATGCCAAAACTTGCCCCAACCTTCAA
ACCATTGTGCGCAGTGCAATGAGGCAAGCTGTTGCTAAAGAAGCCAGGATTGGTGCCTCTATTCTTCGCTTGTTCTTTCATGATTGCTTTGTAAAT
GTAAAGCCTCTAGCTACCCCCTCT
TTGCATCTATGGCTCACAAAATTCTTAGATACTAAATTAAGCTAATAAGCTCACATCTTATTCCGTATAATATAGGCTAGCTAGCTAGGATCAACTATGTCCAAATGGAAACCAAATTTA
CACTTTTAACCTCTGGATTTTCAATCTCATACCTTCTTTTGTTTACCTTTTCAATTTTTTTTTGGTTGCATCTCAAAACTTTTTAATACATTAAAAAATGGATTTCATTTGAATTATTTT
GTAATATTGTTATGTAAACTAGTATGACCTCGAAGCATGTATGGCATTGTAAAATGCAAGTTTGTATAGGTGGTTAGGAGTAAGAAAATAGCTTCATTCAACCCAAAAATTAGTTTTAAG
TTGTTAACTGGATTGTCTAAGTTATTATAATTAAGTATTTTATTTTCAGTTCATAACTAGCCAAGACCTGATCTTAGCAATTTGCACAAAGGGTTTTAGGTTCAAGTTATCAATTTTTTT
GAAGGTGCCCTCAAAAGATTCTATTTTTAATTTTAATTATTTCTTTGAATCATATGCGCAGGGCTGTGATGGATCAATCTTATTGGACGACACTGCCACCTTCACTGGCGAGAAAAATGC
AGGACCTAACAGAAATTCAGCGAGGGGCTTCGAAGTTATTGATACCATTAAAACCAACGTTGAAGCTTCTTGCAATGCCACCGTTTCTTGTGCTGATATCCTAGCACTTGCCACAAGAGA
CGGAGTTGTGCTG
GTGAGCCAACTATCCATAATTTCTTTGGCAAATTCTTCATCTATAACAAACTGAATGATATGCATAGTGTATCACAAGAATTAGCAATATCTAACTACTTTTTTAAT
TTATTTTTTATTATTGATTGAAATTTATTAGAAACTATAAAATATTACATGTCCTATTTTTTTTATTTTATAAGTTTAATGAATTTTAAACAATAATAAAATGGGTCTAGAATACACTTA
AGTAGGGGTCTAATTAAAGAGGCTTAAAAATGGGTCAAGATGTTTTTTATTATAGGTCTTACAAGAAAAAGAAAGAGAAGGAATAATAAGGGAATTAAAAGGGGGTGGAAGGCATTATTG
GTGGTCAAATTTGCACATACTCACGTCACGTAGGGGAATGAGTCTAAATTCTTTCCCGTGTGGGGAAGTAGATCTCAGTGTGGAAAAGTTAGGCACAAGATTTTAGGGACAGTATTCTAA
TAAGAAGGGCATTTAGGATGCATAAAACTTTTGAAGTTTTAACATTGTAAATAATCGATTACATTGAGTAAGGAATTGATCAATTAGAATAATGTATTTAGCATCAGTAATTAGCGAATC
CATACTCACCGTTACTGTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAAGAAGTAGTGTGCAGGCTTTTTCCTTCTCCCATTGAG
ACCGTGTGCTGTTCTCACTGAGATTTCAACGTGAAGTCACTCTCAGAAAGTAGCTAAAAGTCACTCTCAGAAAGTAGCTAACTTGATGTTGCTTTCTTTATTTCCATTTTCTTCGGCATG
AATATATCCTATTTTCAAACCTTGTCCCCCACTTTCGGTTTCACTTTTCTAGCATAATCGACCATCATGCAATGTAGTGGGGTATCCAATAATATCACGCAAAACACACACATTAAACAA
AATAATTTTAAAAAATAATTAAAAAAAAGCACACACACACCAAGGTTCATGTGTCATGCCTATATCTTATCTCTTTATGAAGAAAATTCCACATTATCATGCATCTCTACATAAACAAAT
AAGATAATCAAGAGAAATTTAATGGTATACCTAAGAAATTTAAAGATTTTGATATTGAAACTTTTTTTTTCATCTATCTTCGCGCACACAAAATAAACTATTTGCTTAACAATGTAAAAA
CCTTCTATATTATCATCTAATCATAAACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAATTTATTAATTTTTATTATAATTATCTTAGT
AAAAGATATATATTTCTTTCACGTTGTTTTATAAAATTGATGTGCGTGGGNNNNNNNNNNNNNNNNNNNNNNACAAAAACACCCGATATGATAAGCCAAACACGCTGACACTACTGATGA
TAGTTTTTAATTGATTGAAACTATAAGTATTTTTTAGTAAATTGGAGGAGAAGAGAAGGAGAAAAAAGTTGATAGATTCAATTTTTCTCGTTAATAAAAAAATAATAATTAACAACAAAC
ATCGATAAATAAATAAAAAACTATAAATATTTATAATACATTAAAAATTTGTTACAATAATTATGTCTTGTTTTCACTACTTTATGACTAAAAATTTATTTAACCCATTGTGATTTGCAG

CTAGGAGGACCCTCGTGGAGCGTCCCACTTGGAAGAAGAGATGCAAGAACAGCAAGCCAGAGTGCAGCCAACAGCCAAATCCCAGGACCATCCTCGGACCTCTCAACCCTAACATCAATG
TTTGCAGCCAAAGGCCTAACCTCAAGTGACTTAACCGTGCTCTCTGGAGGCCACACAATAGGCCAAGCACAATGCCAGTTCTTCAGGAACCGCATATACAACGAAACCAACATAGACACC
AACTTCGCCACCACCAGAAAAGCCAATTGCCCTGCCACCGGTGGGAACACCAACCTGGCCCCTCTCGACACCCTCACCCCCAACCGCTTCGACAACAATTACTTCTCCGACCTCGTTAAC
GGCCGCGGCCTTCTCCACTCCGACCAAGTTCTCTTCAATGGTGGGTCTCAGGATGCCCTTGTGAGGACCTACAGTGGCAACAATGCTGCATTCTTTAGGGACTTTGCTGCTGCCATGGTG
AAGTTGGGCAACATTAGTCCCCTCACTGGGTCCAGTGGGGAGATCAGAAGGAATTGCAGGGTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAATTCCCTTAATAACCACCTGTTTGTTGTAGTATCTATTCTTTCTCTCTTAGCCTTTTCTAGCAACGCACAACTATCTCCCACCTTCTATGCCAAAACTTGCCCCAACCTTCAA
ACCATTGTGCGCAGTGCAATGAGGCAAGCTGTTGCTAAAGAAGCCAGGATTGGTGCCTCTATTCTTCGCTTGTTCTTTCATGATTGCTTTGTAAAT
GGCTGTGATGGATCAATCTTATTG
GACGACACTGCCACCTTCACTGGCGAGAAAAATGCAGGACCTAACAGAAATTCAGCGAGGGGCTTCGAAGTTATTGATACCATTAAAACCAACGTTGAAGCTTCTTGCAATGCCACCGTT
TCTTGTGCTGATATCCTAGCACTTGCCACAAGAGACGGAGTTGTGCTG
CTAGGAGGACCCTCGTGGAGCGTCCCACTTGGAAGAAGAGATGCAAGAACAGCAAGCCAGAGTGCAGCCAAC
AGCCAAATCCCAGGACCATCCTCGGACCTCTCAACCCTAACATCAATGTTTGCAGCCAAAGGCCTAACCTCAAGTGACTTAACCGTGCTCTCTGGAGGCCACACAATAGGCCAAGCACAA
TGCCAGTTCTTCAGGAACCGCATATACAACGAAACCAACATAGACACCAACTTCGCCACCACCAGAAAAGCCAATTGCCCTGCCACCGGTGGGAACACCAACCTGGCCCCTCTCGACACC
CTCACCCCCAACCGCTTCGACAACAATTACTTCTCCGACCTCGTTAACGGCCGCGGCCTTCTCCACTCCGACCAAGTTCTCTTCAATGGTGGGTCTCAGGATGCCCTTGTGAGGACCTAC
AGTGGCAACAATGCTGCATTCTTTAGGGACTTTGCTGCTGCCATGGTGAAGTTGGGCAACATTAGTCCCCTCACTGGGTCCAGTGGGGAGATCAGAAGGAATTGCAGGGTTGTGAATTGA

Retrieve as FASTA