Entry information : GzKat04
Entry ID 5230
Creation 2007-04-16 (Marcel Zamocky)
Last sequence changes 2007-04-16 (Marcel Zamocky)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-27 (Achraf Jemmat)
Peroxidase information: GzKat04
Name GzKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzKat04
start..stop
S start..stop
FoKat01 1000 0 1..549 1..577
CfulKat01 811 0 1..516 1..545
CnKat02_JEC21 705 0 18..537 160..701
CnKat02_grubiiH99 702 0 18..537 160..701
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..441 441 N° 2 616..743 128 N° 3 797..1880 1084  
join(1..441,616..743,797..1880)


exon

Literature and cross-references GzKat04
Literature King,R. et al., The completed genome sequence of the pathogenic ascomycete fungus Fusarium graminearum. BMC Genomics 16, 544 (2015)
Protein ref. GenBank:   ESU11694.1
DNA ref. GenBank:   HG970334.1 (3119912..3121791) JGI genome:   Supercontig_3.3 (3118527..3120406)
Protein sequence: GzKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   550
PWM (Da):   %s   61826.29  
PI (pH):   %s   6.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPSADTSFSAHVASQFQSYEEDRQSASKESTYATSNGVPVAHAYEAQRCGENGPLLLQDFHLIDLLSHFDRERIPERVVHAKGSGAHGFFECTDPLDDLCLADIFSAKGKKCPVSMRFSTVGGESGSHDMARDPRGFSVKMRTEEGYLTVTGTHLTHADDSFAFWDYLSQNPESIHQVMILMGDRGIPKGYRKMHGYSGHTFKLVNKAGDWVYTQIHLKSMQGTDFVTQEDSADYSPDFSQKDLYEAIQNGDYPKWTLEVQTMTPKEAEELWEKEKINVFDLTHVWPQKQFPRRKVGEFTLNENAINYFAEVEQIAFNPAHLPPGIEPSADPVLQSRLFSYPDTHRHRIGVNYQQLPVNATRTGYKFGNFQRDGQMAFYNQGARPNYLSSIDPIKFRTRTVDLDKTHGHFTGEAITFLTAIRPEDFNAPRALWRNVFDEPARERFINNVTGKMKLCKQEEPLKRQIAIFREVDPEIADRLEKSTGIKGYDGIADMKFNGSHNCMNGEMKLANDIIANKGKSATARNGAPAKGCHSRLETNGHLNGTNGK

Retrieve as FASTA  
Remarks Complete from genomic (chromo 3). No EST available. Contig position: 1-1728. Strain="PH-1/NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCATCAGCAGACACTTCATTCTCGGCTCACGTAGCCAGCCAGTTTCAGTCCTACGAGGAAGATCGACAGTCAGCCTCCAAGGAATCAACTTATGCTACCAGCAACGGCGTCCCT
GTGGCTCACGCCTACGAGGCCCAACGATGCGGCGAGAATGGGCCTCTTCTTCTCCAAGACTTTCACCTAATTGATCTCCTTTCTCATTTCGATCGAGAGCGTATCCCTGAGCGAGTTGTT
CACGCCAAGGGCAGTGGTGCTCATGGATTCTTTGAGTGTACCGACCCTCTCGATGATCTGTGTCTTGCCGACATCTTTTCCGCCAAGGGAAAGAAATGTCCTGTTTCCATGAGATTTTCG
ACAGTCGGAGGAGAGTCTGGATCGCATGATATGGCCAGAGACCCTCGTGGATTCTCTGTCAAGATGCGAACTGAGGAGGGT
GTAAGTGAAGTGACACCACACTGCGAGGGCCATGCTAAC
AAGCCCCCAGAACTTGGATTGGGTTTTCAACAACACTCCCGTCTTCTTTTTGAGAGATCCCGCCAAGTTTCCTCACTTTATTCACACTCAAAAGCGCGATCCCAGTAAGTCTGCCACCTT
ACATGGTCATATCAGTATCTAACAGTTACAGGTACTCATCTAACTCATGCTGATGATTCATTCGCTTTCTGGGACTACCTTTCTCAGAACCCCGAGTCAATTCATCAAGTAATGATCTTG
ATGGGCGATCGTGGTATTCCCAA
GTGAGTACACTGGTTAAATATCAGATATCAGTGCGTCTACTAACAACGAACAGGGGATACAGAAAGATGCACGGTTACTCTGGACACACTTTCAAGC
TCGTGAACAAAGCCGGCGACTGGGTGTACACCCAAATACACCTCAAGTCCATGCAAGGAACCGACTTTGTTACTCAGGAGGACTCGGCCGATTACTCACCCGACTTCTCCCAGAAGGATC
TCTACGAGGCTATCCAGAACGGAGACTACCCCAAGTGGACTCTCGAAGTGCAGACTATGACTCCCAAGGAAGCTGAGGAGTTATGGGAGAAGGAGAAGATCAATGTCTTTGATCTCACCC
ACGTCTGGCCTCAGAAGCAGTTCCCTCGTCGCAAGGTTGGAGAGTTTACTCTCAATGAGAACGCTATCAACTACTTTGCCGAGGTTGAGCAGATTGCTTTCAACCCAGCTCACTTACCTC
CTGGTATTGAGCCTTCAGCAGACCCTGTTCTTCAGTCACGCTTGTTCTCTTACCCTGATACACACCGTCACCGCATTGGAGTCAACTACCAACAACTCCCCGTCAATGCCACACGTACAG
GATACAAGTTTGGCAACTTCCAGCGCGACGGCCAGATGGCCTTCTACAACCAGGGTGCCCGACCTAACTACCTCTCGTCCATTGATCCTATCAAGTTCCGTACCCGAACCGTGGATCTCG
ACAAGACACACGGTCACTTCACAGGCGAAGCCATCACATTCCTCACAGCAATCCGCCCCGAGGACTTTAATGCTCCTCGCGCCTTGTGGAGGAACGTATTTGACGAGCCAGCTCGCGAGC
GTTTCATCAACAATGTTACTGGCAAGATGAAGCTCTGCAAGCAGGAGGAGCCTCTGAAGCGACAGATTGCCATCTTCCGCGAGGTAGACCCTGAGATTGCCGATAGACTCGAAAAGTCAA
CAGGCATCAAGGGATACGATGGAATTGCTGATATGAAGTTTAATGGAAGCCACAATTGTATGAATGGCGAAATGAAGCTTGCAAATGACATTATCGCGAACAAGGGGAAGAGTGCTACTG
CAAGGAACGGTGCCCCGGCAAAGGGATGCCACTCAAGACTGGAGACGAATGGACACTTGAACGGAACAAATGGTAAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCATCAGCAGACACTTCATTCTCGGCTCACGTAGCCAGCCAGTTTCAGTCCTACGAGGAAGATCGACAGTCAGCCTCCAAGGAATCAACTTATGCTACCAGCAACGGCGTCCCT
GTGGCTCACGCCTACGAGGCCCAACGATGCGGCGAGAATGGGCCTCTTCTTCTCCAAGACTTTCACCTAATTGATCTCCTTTCTCATTTCGATCGAGAGCGTATCCCTGAGCGAGTTGTT
CACGCCAAGGGCAGTGGTGCTCATGGATTCTTTGAGTGTACCGACCCTCTCGATGATCTGTGTCTTGCCGACATCTTTTCCGCCAAGGGAAAGAAATGTCCTGTTTCCATGAGATTTTCG
ACAGTCGGAGGAGAGTCTGGATCGCATGATATGGCCAGAGACCCTCGTGGATTCTCTGTCAAGATGCGAACTGAGGAGGGT
TATCTAACAGTTACAGGTACTCATCTAACTCATGCTGAT
GATTCATTCGCTTTCTGGGACTACCTTTCTCAGAACCCCGAGTCAATTCATCAAGTAATGATCTTGATGGGCGATCGTGGTATTCCCAA
GGGATACAGAAAGATGCACGGTTACTCTGGA
CACACTTTCAAGCTCGTGAACAAAGCCGGCGACTGGGTGTACACCCAAATACACCTCAAGTCCATGCAAGGAACCGACTTTGTTACTCAGGAGGACTCGGCCGATTACTCACCCGACTTC
TCCCAGAAGGATCTCTACGAGGCTATCCAGAACGGAGACTACCCCAAGTGGACTCTCGAAGTGCAGACTATGACTCCCAAGGAAGCTGAGGAGTTATGGGAGAAGGAGAAGATCAATGTC
TTTGATCTCACCCACGTCTGGCCTCAGAAGCAGTTCCCTCGTCGCAAGGTTGGAGAGTTTACTCTCAATGAGAACGCTATCAACTACTTTGCCGAGGTTGAGCAGATTGCTTTCAACCCA
GCTCACTTACCTCCTGGTATTGAGCCTTCAGCAGACCCTGTTCTTCAGTCACGCTTGTTCTCTTACCCTGATACACACCGTCACCGCATTGGAGTCAACTACCAACAACTCCCCGTCAAT
GCCACACGTACAGGATACAAGTTTGGCAACTTCCAGCGCGACGGCCAGATGGCCTTCTACAACCAGGGTGCCCGACCTAACTACCTCTCGTCCATTGATCCTATCAAGTTCCGTACCCGA
ACCGTGGATCTCGACAAGACACACGGTCACTTCACAGGCGAAGCCATCACATTCCTCACAGCAATCCGCCCCGAGGACTTTAATGCTCCTCGCGCCTTGTGGAGGAACGTATTTGACGAG
CCAGCTCGCGAGCGTTTCATCAACAATGTTACTGGCAAGATGAAGCTCTGCAAGCAGGAGGAGCCTCTGAAGCGACAGATTGCCATCTTCCGCGAGGTAGACCCTGAGATTGCCGATAGA
CTCGAAAAGTCAACAGGCATCAAGGGATACGATGGAATTGCTGATATGAAGTTTAATGGAAGCCACAATTGTATGAATGGCGAAATGAAGCTTGCAAATGACATTATCGCGAACAAGGGG
AAGAGTGCTACTGCAAGGAACGGTGCCCCGGCAAAGGGATGCCACTCAAGACTGGAGACGAATGGACACTTGAACGGAACAAATGGTAAATAG

Retrieve as FASTA